Incidental Mutation 'R8272:Chuk'
ID637818
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8272 (G1)
Quality Score163.009
Status Not validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44103736 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 41 (I41T)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000026218] [ENSMUST00000119591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026217
AA Change: I41T

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: I41T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026218
SMART Domains Protein: ENSMUSP00000026218
Gene: ENSMUSG00000025200

DomainStartEndE-ValueType
Pfam:CwfJ_C_1 314 433 5.6e-37 PFAM
Pfam:CwfJ_C_2 439 534 2.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119591
AA Change: I41T

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: I41T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
4933407L21Rik G T 1: 85,931,397 E90* probably null Het
Abca15 A G 7: 120,407,442 Y1643C probably damaging Het
Adtrp G T 13: 41,816,154 A123D probably damaging Het
Asmt A T X: 170,672,725 D20V possibly damaging Het
BC067074 A T 13: 113,368,355 D1979V Het
Bid T C 6: 120,900,215 E55G probably damaging Het
Brd3 A G 2: 27,461,713 V176A probably benign Het
Btnl2 G T 17: 34,356,301 probably null Het
Card11 A G 5: 140,890,039 S562P probably damaging Het
Casp8 T G 1: 58,833,742 M259R probably damaging Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cfap45 G A 1: 172,527,839 R18Q possibly damaging Het
Col28a1 G A 6: 8,154,175 P333L possibly damaging Het
Ctnna3 T G 10: 65,002,598 V818G probably damaging Het
Cyp4f18 G T 8: 71,989,091 L456M probably benign Het
Ddx50 A G 10: 62,621,477 V598A probably benign Het
Dhrs7b C A 11: 60,851,754 Q91K probably benign Het
Dnah11 T A 12: 118,111,017 T1367S probably benign Het
Fam98b T A 2: 117,262,854 C183S probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxw15 A C 9: 109,559,760 S194A probably benign Het
Flrt3 G T 2: 140,660,697 P337Q probably damaging Het
Gm12695 A G 4: 96,723,946 Y527H possibly damaging Het
Gramd1b T C 9: 40,304,524 T677A probably benign Het
Grm8 A T 6: 27,363,282 S745T probably damaging Het
Kctd8 T C 5: 69,110,460 K436E probably benign Het
Klf5 G T 14: 99,302,104 A318S possibly damaging Het
L3mbtl3 C T 10: 26,303,668 V505M unknown Het
Letm2 A G 8: 25,586,656 L310P probably damaging Het
Lrrc16a T G 13: 24,036,579 H1054P probably benign Het
Lrrc4 T C 6: 28,662,193 H174R unknown Het
Myh11 T C 16: 14,218,854 S995G Het
Myh7b A T 2: 155,632,904 E1787D probably damaging Het
Myoc T C 1: 162,639,426 S55P probably benign Het
Naaladl2 T C 3: 24,058,202 Q572R probably damaging Het
Nanog T A 6: 122,711,777 S131T probably benign Het
Nifk A G 1: 118,332,404 K230E probably benign Het
Nlrp10 A G 7: 108,925,896 S126P probably benign Het
Npc1l1 T A 11: 6,229,327 K28* probably null Het
Olfr1454 G A 19: 13,063,431 V7M possibly damaging Het
Olfr451-ps1 A G 6: 42,801,104 D121G probably damaging Het
Pcdhac2 T A 18: 37,146,189 C741S probably benign Het
Pcx A T 19: 4,601,730 N45I probably damaging Het
Peak1 A G 9: 56,258,898 V582A probably damaging Het
Plcxd3 G T 15: 4,516,736 R74L probably damaging Het
Ptpn21 G A 12: 98,688,530 A726V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp3 T C 16: 17,209,105 V131A possibly damaging Het
Rrp1b A G 17: 32,057,189 K570R probably benign Het
Serpinb1a A T 13: 32,845,737 F167L probably damaging Het
Slc12a1 T C 2: 125,228,816 L1076S probably damaging Het
Sspo A T 6: 48,448,519 T25S probably benign Het
Syvn1 G A 19: 6,047,941 R3H probably damaging Het
Tead2 A G 7: 45,228,742 E280G probably benign Het
Tmem263 T A 10: 85,114,567 V74E possibly damaging Het
Tmem38b T A 4: 53,854,332 L188Q probably damaging Het
Tmod4 C T 3: 95,125,860 T55I probably damaging Het
Tmprss12 A T 15: 100,282,265 E62V probably benign Het
Trim27 G A 13: 21,180,610 C39Y probably benign Het
Vmn2r110 A G 17: 20,596,228 L11S probably damaging Het
Vmn2r125 A G 4: 156,350,078 Y53C probably damaging Het
Vmn2r65 A T 7: 84,947,609 F79L probably benign Het
Vps13a A G 19: 16,749,845 probably null Het
Zdbf2 A G 1: 63,305,983 T1174A probably benign Het
Zfhx4 T G 3: 5,243,867 S718A probably damaging Het
Zfp78 A G 7: 6,373,214 T41A probably benign Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTCTTGAGAAAAGAGGCCCC -3'
(R):5'- TGTAGGATCTGCCCAGTCAG -3'

Sequencing Primer
(F):5'- GAAAAGAGGCCCCCGACCTC -3'
(R):5'- GTTTCCCTGGGTTGACAT -3'
Posted On2020-07-28