Incidental Mutation 'R0726:Espl1'
ID 63782
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 038908-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0726 (G1)
Quality Score 126
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102231033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1844 (I1844T)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000229050] [ENSMUST00000170627] [ENSMUST00000169637]
AlphaFold P60330
Predicted Effect probably benign
Transcript: ENSMUST00000001335
SMART Domains Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
SCOP:d1fxkc_ 12 58 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062492
SMART Domains Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064924
AA Change: I1844T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I1844T

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165671
SMART Domains Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165717
SMART Domains Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 72 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166658
SMART Domains Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 22 143 8.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168805
Predicted Effect probably benign
Transcript: ENSMUST00000229050
AA Change: I1844T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230222
Predicted Effect probably benign
Transcript: ENSMUST00000170627
SMART Domains Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 7 99 4.6e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231207
Predicted Effect probably benign
Transcript: ENSMUST00000229942
Predicted Effect probably benign
Transcript: ENSMUST00000169637
SMART Domains Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 58 3.4e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 A G 7: 143,425,498 (GRCm39) D49G probably damaging Het
Alg12 T C 15: 88,690,850 (GRCm39) Y256C probably damaging Het
Alox15 T A 11: 70,241,021 (GRCm39) D160V probably damaging Het
Aox1 T C 1: 58,373,941 (GRCm39) probably benign Het
Bbs9 G T 9: 22,705,119 (GRCm39) A729S probably damaging Het
Bltp3a T C 17: 28,104,463 (GRCm39) V503A possibly damaging Het
Bmp2k T A 5: 97,235,353 (GRCm39) probably benign Het
Braf C T 6: 39,639,082 (GRCm39) R223Q possibly damaging Het
Cd101 A T 3: 100,927,938 (GRCm39) S48T possibly damaging Het
Cdh9 T G 15: 16,831,130 (GRCm39) D322E probably benign Het
Col28a1 C T 6: 8,014,495 (GRCm39) probably null Het
Cpxm1 G A 2: 130,232,859 (GRCm39) R712W probably damaging Het
Csnk1g1 T C 9: 65,939,637 (GRCm39) probably benign Het
Cyp2d37-ps A C 15: 82,574,650 (GRCm39) noncoding transcript Het
Cyth3 T C 5: 143,678,397 (GRCm39) V115A probably benign Het
Dnah9 C T 11: 65,856,507 (GRCm39) V2885M probably damaging Het
Dock9 G T 14: 121,889,180 (GRCm39) Y326* probably null Het
Fam20a T A 11: 109,568,020 (GRCm39) N357Y probably damaging Het
Fancc C A 13: 63,471,225 (GRCm39) R385L probably benign Het
Foxe3 A T 4: 114,782,447 (GRCm39) L255H unknown Het
Frem2 T C 3: 53,427,047 (GRCm39) D2967G possibly damaging Het
Gabra6 T G 11: 42,205,954 (GRCm39) T301P probably damaging Het
Ganab T A 19: 8,888,477 (GRCm39) Y511N probably damaging Het
Grm4 T A 17: 27,657,412 (GRCm39) probably benign Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Kcnj9 G A 1: 172,153,488 (GRCm39) S212F probably damaging Het
Kif15 C A 9: 122,788,993 (GRCm39) H62N probably benign Het
Kptn A G 7: 15,854,647 (GRCm39) D106G probably damaging Het
Krtap13-1 T A 16: 88,526,192 (GRCm39) S139T probably damaging Het
Lepr C A 4: 101,622,131 (GRCm39) N354K probably benign Het
Lypd3 G T 7: 24,337,969 (GRCm39) E112* probably null Het
Med13l A T 5: 118,886,749 (GRCm39) N1550I probably damaging Het
Mettl2 C T 11: 105,017,670 (GRCm39) P60L probably benign Het
Mtcl2 G T 2: 156,902,182 (GRCm39) R278S probably damaging Het
Muc4 A G 16: 32,590,201 (GRCm39) E850G probably damaging Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Nek1 A G 8: 61,542,626 (GRCm39) R739G probably damaging Het
Nipbl A T 15: 8,381,039 (GRCm39) D584E probably benign Het
Nkain3 C T 4: 20,158,388 (GRCm39) V162M possibly damaging Het
Nmrk1 T C 19: 18,618,844 (GRCm39) probably benign Het
Nsd2 T C 5: 34,018,372 (GRCm39) probably benign Het
Or2n1b T C 17: 38,459,515 (GRCm39) F12S probably damaging Het
Or4b1 T A 2: 89,979,627 (GRCm39) H241L probably damaging Het
Or4p23 A T 2: 88,576,352 (GRCm39) N293K probably benign Het
Or5b24 T A 19: 12,912,969 (GRCm39) V289D probably damaging Het
Or8b44 T A 9: 38,410,418 (GRCm39) M151K possibly damaging Het
Otulinl A T 15: 27,657,033 (GRCm39) I338N probably damaging Het
Phex T A X: 156,155,557 (GRCm39) probably benign Het
Pip5k1b G T 19: 24,356,256 (GRCm39) D227E probably damaging Het
Prdm13 A G 4: 21,683,914 (GRCm39) I119T unknown Het
Rab19 G T 6: 39,360,893 (GRCm39) V14L probably benign Het
Rasa3 A G 8: 13,630,118 (GRCm39) probably benign Het
Rgsl1 C T 1: 153,678,074 (GRCm39) S118N probably damaging Het
Rif1 C T 2: 52,000,365 (GRCm39) T1273M possibly damaging Het
Scn8a A G 15: 100,870,711 (GRCm39) N254S probably damaging Het
Sema6a T C 18: 47,425,048 (GRCm39) T188A probably damaging Het
Sh3pxd2a C T 19: 47,257,201 (GRCm39) E506K probably damaging Het
Smarca2 A T 19: 26,675,803 (GRCm39) K1014N probably damaging Het
Smarca4 T G 9: 21,611,435 (GRCm39) probably null Het
Sntb1 T C 15: 55,539,752 (GRCm39) R361G probably benign Het
Stx5a T A 19: 8,732,275 (GRCm39) I208N probably damaging Het
Tas2r102 T A 6: 132,739,415 (GRCm39) W108R probably damaging Het
Tcl1 A G 12: 105,184,929 (GRCm39) Y94H probably damaging Het
Tenm3 T A 8: 48,689,629 (GRCm39) Y1986F probably damaging Het
Tet2 G A 3: 133,173,945 (GRCm39) P1439L probably benign Het
Tiam2 T C 17: 3,563,108 (GRCm39) probably benign Het
Ubap2l G A 3: 89,928,553 (GRCm39) T526M probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ushbp1 T A 8: 71,841,391 (GRCm39) probably benign Het
Usp28 C T 9: 48,915,169 (GRCm39) R115C probably damaging Het
Vldlr A T 19: 27,215,786 (GRCm39) D261V probably damaging Het
Vmn2r5 C T 3: 64,411,186 (GRCm39) D461N probably benign Het
Vmn2r86 A T 10: 130,282,265 (GRCm39) F784I probably damaging Het
Zfp59 A T 7: 27,553,513 (GRCm39) I322F probably damaging Het
Zfp607a A T 7: 27,578,574 (GRCm39) H548L probably benign Het
Zfp626 G A 7: 27,518,048 (GRCm39) C343Y probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGAAGGATGTAGACCCGTTG -3'
(R):5'- TTACCCTTGGGACACCGTTCATGC -3'

Sequencing Primer
(F):5'- AGTGACATCTCCAACCTTTGAGTG -3'
(R):5'- CACCGTTCATGCCCCAG -3'
Posted On 2013-07-30