Mutagenetix > Incidental Mutation

Incidental Mutation 'R0726:Espl1'

63782

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

038908-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0726 (G1)

Quality Score

126

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102322598 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1844 (I1844T)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000001335

SMART Domains

Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
SCOP:d1fxkc_	12	58	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062492

SMART Domains

Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: I1844T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I1844T

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165671

SMART Domains

Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165717

SMART Domains

Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	72	1.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166658

SMART Domains

Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	22	143	8.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168805

Predicted Effect

probably benign
Transcript: ENSMUST00000169637

SMART Domains

Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	58	3.4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170627

SMART Domains

Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	7	99	4.6e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: I1844T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000229942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231207

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.1%
20x: 89.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg12	T	C	15: 88,806,647	Y256C	probably damaging	Het
Alox15	T	A	11: 70,350,195	D160V	probably damaging	Het
Aox2	T	C	1: 58,334,782		probably benign	Het
Bbs9	G	T	9: 22,793,823	A729S	probably damaging	Het
Bmp2k	T	A	5: 97,087,494		probably benign	Het
Braf	C	T	6: 39,662,148	R223Q	possibly damaging	Het
Cd101	A	T	3: 101,020,622	S48T	possibly damaging	Het
Cdh9	T	G	15: 16,831,044	D322E	probably benign	Het
Col28a1	C	T	6: 8,014,495		probably null	Het
Cpxm1	G	A	2: 130,390,939	R712W	probably damaging	Het
Csnk1g1	T	C	9: 66,032,355		probably benign	Het
Cyp2d37-ps	A	C	15: 82,690,449		noncoding transcript	Het
Cyth3	T	C	5: 143,692,642	V115A	probably benign	Het
Dnah9	C	T	11: 65,965,681	V2885M	probably damaging	Het
Dock9	G	T	14: 121,651,768	Y326*	probably null	Het
Fam105a	A	T	15: 27,656,947	I338N	probably damaging	Het
Fam20a	T	A	11: 109,677,194	N357Y	probably damaging	Het
Fancc	C	A	13: 63,323,411	R385L	probably benign	Het
Foxe3	A	T	4: 114,925,250	L255H	unknown	Het
Frem2	T	C	3: 53,519,626	D2967G	possibly damaging	Het
Gabra6	T	G	11: 42,315,127	T301P	probably damaging	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gm498	A	G	7: 143,871,761	D49G	probably damaging	Het
Grm4	T	A	17: 27,438,438		probably benign	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Kcnj9	G	A	1: 172,325,921	S212F	probably damaging	Het
Kif15	C	A	9: 122,959,928	H62N	probably benign	Het
Kptn	A	G	7: 16,120,722	D106G	probably damaging	Het
Krtap13-1	T	A	16: 88,729,304	S139T	probably damaging	Het
Lepr	C	A	4: 101,764,934	N354K	probably benign	Het
Lypd3	G	T	7: 24,638,544	E112*	probably null	Het
Med13l	A	T	5: 118,748,684	N1550I	probably damaging	Het
Mettl2	C	T	11: 105,126,844	P60L	probably benign	Het
Muc4	A	G	16: 32,769,827	E850G	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nek1	A	G	8: 61,089,592	R739G	probably damaging	Het
Nipbl	A	T	15: 8,351,555	D584E	probably benign	Het
Nkain3	C	T	4: 20,158,388	V162M	possibly damaging	Het
Nmrk1	T	C	19: 18,641,480		probably benign	Het
Nsd2	T	C	5: 33,861,028		probably benign	Het
Olfr1198	A	T	2: 88,746,008	N293K	probably benign	Het
Olfr1270	T	A	2: 90,149,283	H241L	probably damaging	Het
Olfr133	T	C	17: 38,148,624	F12S	probably damaging	Het
Olfr1449	T	A	19: 12,935,605	V289D	probably damaging	Het
Olfr907	T	A	9: 38,499,122	M151K	possibly damaging	Het
Phex	T	A	X: 157,372,561		probably benign	Het
Pip5k1b	G	T	19: 24,378,892	D227E	probably damaging	Het
Prdm13	A	G	4: 21,683,914	I119T	unknown	Het
Rab19	G	T	6: 39,383,959	V14L	probably benign	Het
Rasa3	A	G	8: 13,580,118		probably benign	Het
Rgsl1	C	T	1: 153,802,328	S118N	probably damaging	Het
Rif1	C	T	2: 52,110,353	T1273M	possibly damaging	Het
Scn8a	A	G	15: 100,972,830	N254S	probably damaging	Het
Sema6a	T	C	18: 47,291,981	T188A	probably damaging	Het
Sh3pxd2a	C	T	19: 47,268,762	E506K	probably damaging	Het
Smarca2	A	T	19: 26,698,403	K1014N	probably damaging	Het
Smarca4	T	G	9: 21,700,139		probably null	Het
Sntb1	T	C	15: 55,676,356	R361G	probably benign	Het
Soga1	G	T	2: 157,060,262	R278S	probably damaging	Het
Stx5a	T	A	19: 8,754,911	I208N	probably damaging	Het
Tas2r102	T	A	6: 132,762,452	W108R	probably damaging	Het
Tcl1	A	G	12: 105,218,670	Y94H	probably damaging	Het
Tenm3	T	A	8: 48,236,594	Y1986F	probably damaging	Het
Tet2	G	A	3: 133,468,184	P1439L	probably benign	Het
Tiam2	T	C	17: 3,512,833		probably benign	Het
Ubap2l	G	A	3: 90,021,246	T526M	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,489	V503A	possibly damaging	Het
Ushbp1	T	A	8: 71,388,747		probably benign	Het
Usp28	C	T	9: 49,003,869	R115C	probably damaging	Het
Vldlr	A	T	19: 27,238,386	D261V	probably damaging	Het
Vmn2r5	C	T	3: 64,503,765	D461N	probably benign	Het
Vmn2r86	A	T	10: 130,446,396	F784I	probably damaging	Het
Zfp59	A	T	7: 27,854,088	I322F	probably damaging	Het
Zfp607a	A	T	7: 27,879,149	H548L	probably benign	Het
Zfp626	G	A	7: 27,818,623	C343Y	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTGAAGGATGTAGACCCGTTG -3'
(R):5'- TTACCCTTGGGACACCGTTCATGC -3'

Sequencing Primer
(F):5'- AGTGACATCTCCAACCTTTGAGTG -3'
(R):5'- CACCGTTCATGCCCCAG -3'

Posted On

2013-07-30