Mutagenetix > Incidental Mutation

Incidental Mutation 'R0726:Mylk'

63783

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210

MMRRC Submission

038908-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0726 (G1)

Quality Score

151

Status

Validated

Chromosome

Chromosomal Location

34745210-35002420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 34879475 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 403 (E403Q)

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023538
AA Change: E403Q

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: E403Q

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155268

Meta Mutation Damage Score

0.0630

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.1%
20x: 89.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg12	T	C	15: 88,806,647	Y256C	probably damaging	Het
Alox15	T	A	11: 70,350,195	D160V	probably damaging	Het
Aox2	T	C	1: 58,334,782		probably benign	Het
Bbs9	G	T	9: 22,793,823	A729S	probably damaging	Het
Bmp2k	T	A	5: 97,087,494		probably benign	Het
Braf	C	T	6: 39,662,148	R223Q	possibly damaging	Het
Cd101	A	T	3: 101,020,622	S48T	possibly damaging	Het
Cdh9	T	G	15: 16,831,044	D322E	probably benign	Het
Col28a1	C	T	6: 8,014,495		probably null	Het
Cpxm1	G	A	2: 130,390,939	R712W	probably damaging	Het
Csnk1g1	T	C	9: 66,032,355		probably benign	Het
Cyp2d37-ps	A	C	15: 82,690,449		noncoding transcript	Het
Cyth3	T	C	5: 143,692,642	V115A	probably benign	Het
Dnah9	C	T	11: 65,965,681	V2885M	probably damaging	Het
Dock9	G	T	14: 121,651,768	Y326*	probably null	Het
Espl1	T	C	15: 102,322,598	I1844T	probably benign	Het
Fam105a	A	T	15: 27,656,947	I338N	probably damaging	Het
Fam20a	T	A	11: 109,677,194	N357Y	probably damaging	Het
Fancc	C	A	13: 63,323,411	R385L	probably benign	Het
Foxe3	A	T	4: 114,925,250	L255H	unknown	Het
Frem2	T	C	3: 53,519,626	D2967G	possibly damaging	Het
Gabra6	T	G	11: 42,315,127	T301P	probably damaging	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gm498	A	G	7: 143,871,761	D49G	probably damaging	Het
Grm4	T	A	17: 27,438,438		probably benign	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Kcnj9	G	A	1: 172,325,921	S212F	probably damaging	Het
Kif15	C	A	9: 122,959,928	H62N	probably benign	Het
Kptn	A	G	7: 16,120,722	D106G	probably damaging	Het
Krtap13-1	T	A	16: 88,729,304	S139T	probably damaging	Het
Lepr	C	A	4: 101,764,934	N354K	probably benign	Het
Lypd3	G	T	7: 24,638,544	E112*	probably null	Het
Med13l	A	T	5: 118,748,684	N1550I	probably damaging	Het
Mettl2	C	T	11: 105,126,844	P60L	probably benign	Het
Muc4	A	G	16: 32,769,827	E850G	probably damaging	Het
Nek1	A	G	8: 61,089,592	R739G	probably damaging	Het
Nipbl	A	T	15: 8,351,555	D584E	probably benign	Het
Nkain3	C	T	4: 20,158,388	V162M	possibly damaging	Het
Nmrk1	T	C	19: 18,641,480		probably benign	Het
Nsd2	T	C	5: 33,861,028		probably benign	Het
Olfr1198	A	T	2: 88,746,008	N293K	probably benign	Het
Olfr1270	T	A	2: 90,149,283	H241L	probably damaging	Het
Olfr133	T	C	17: 38,148,624	F12S	probably damaging	Het
Olfr1449	T	A	19: 12,935,605	V289D	probably damaging	Het
Olfr907	T	A	9: 38,499,122	M151K	possibly damaging	Het
Phex	T	A	X: 157,372,561		probably benign	Het
Pip5k1b	G	T	19: 24,378,892	D227E	probably damaging	Het
Prdm13	A	G	4: 21,683,914	I119T	unknown	Het
Rab19	G	T	6: 39,383,959	V14L	probably benign	Het
Rasa3	A	G	8: 13,580,118		probably benign	Het
Rgsl1	C	T	1: 153,802,328	S118N	probably damaging	Het
Rif1	C	T	2: 52,110,353	T1273M	possibly damaging	Het
Scn8a	A	G	15: 100,972,830	N254S	probably damaging	Het
Sema6a	T	C	18: 47,291,981	T188A	probably damaging	Het
Sh3pxd2a	C	T	19: 47,268,762	E506K	probably damaging	Het
Smarca2	A	T	19: 26,698,403	K1014N	probably damaging	Het
Smarca4	T	G	9: 21,700,139		probably null	Het
Sntb1	T	C	15: 55,676,356	R361G	probably benign	Het
Soga1	G	T	2: 157,060,262	R278S	probably damaging	Het
Stx5a	T	A	19: 8,754,911	I208N	probably damaging	Het
Tas2r102	T	A	6: 132,762,452	W108R	probably damaging	Het
Tcl1	A	G	12: 105,218,670	Y94H	probably damaging	Het
Tenm3	T	A	8: 48,236,594	Y1986F	probably damaging	Het
Tet2	G	A	3: 133,468,184	P1439L	probably benign	Het
Tiam2	T	C	17: 3,512,833		probably benign	Het
Ubap2l	G	A	3: 90,021,246	T526M	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,489	V503A	possibly damaging	Het
Ushbp1	T	A	8: 71,388,747		probably benign	Het
Usp28	C	T	9: 49,003,869	R115C	probably damaging	Het
Vldlr	A	T	19: 27,238,386	D261V	probably damaging	Het
Vmn2r5	C	T	3: 64,503,765	D461N	probably benign	Het
Vmn2r86	A	T	10: 130,446,396	F784I	probably damaging	Het
Zfp59	A	T	7: 27,854,088	I322F	probably damaging	Het
Zfp607a	A	T	7: 27,879,149	H548L	probably benign	Het
Zfp626	G	A	7: 27,818,623	C343Y	probably damaging	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34938952	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34971240	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34971940	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34988877	splice site	probably benign
IGL02079:Mylk	APN	16	34860631	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34815435	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34929896	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34963646	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34986541	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34914900	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34921788	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34952781	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34912192	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34979189	missense	probably benign	0.09
billy	UTSW	16	34875620	missense	probably damaging	0.97
brutus	UTSW	16	34953695	missense	probably benign	0.12
Club	UTSW	16	34912275	nonsense	probably null
popeye	UTSW	16	34963577	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34995204	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34977113	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34875642	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34875504	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34912297	splice site	probably benign
R0358:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34784974	splice site	probably null
R0390:Mylk	UTSW	16	34875620	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34921944	missense	probably benign	0.01
R0536:Mylk	UTSW	16	35000387	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	35000429	missense	probably damaging	1.00
R0755:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34874039	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34860652	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34815465	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34875586	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34875635	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34921944	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34952782	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34912230	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34880303	splice site	probably null
R2016:Mylk	UTSW	16	34996817	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34953653	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34986476	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34880168	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34921877	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34963577	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34912275	nonsense	probably null
R4470:Mylk	UTSW	16	34912152	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34953695	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34922435	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34879169	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34894925	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34922367	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34914990	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34988961	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34971440	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34899507	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34988997	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34977013	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34979215	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34922625	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34921757	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34912230	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34921604	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34879352	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34956492	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34894947	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34894843	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34921971	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34860591	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34929867	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34929888	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34874150	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34880273	missense	probably benign	0.18
R6949:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	35000426	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34976982	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34785011	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34914076	splice site	probably null
R7525:Mylk	UTSW	16	34988987	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34922517	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34894814	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34879557	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34922183	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34963648	nonsense	probably null
R7892:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34914155	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	35000351	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34922579	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34929887	missense	possibly damaging	0.87
R8721:Mylk	UTSW	16	34996806	missense	probably damaging	1.00
R8743:Mylk	UTSW	16	34921057	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34899402	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34971409	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34956465	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34875642	nonsense	probably null
R9624:Mylk	UTSW	16	34879307	missense	probably benign	0.29
R9735:Mylk	UTSW	16	34914809	missense	probably benign	0.09
R9756:Mylk	UTSW	16	34914017	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34879112	nonsense	probably null
RF001:Mylk	UTSW	16	34879371	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34995204	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34995204	critical splice donor site	probably null
X0065:Mylk	UTSW	16	35000441	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34922651	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGTGTGAGGATGCTCCCAGAAAGG -3'
(R):5'- TGCATACATACGGGAGGTGCAGAC -3'

Sequencing Primer
(F):5'- AAAGGTCCCGCAGTCCTC -3'
(R):5'- GGAGGTGCAGACTGGTG -3'

Posted On

2013-07-30