Incidental Mutation 'R8273:1110002E22Rik'
ID637834
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R8273 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138066450 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 467 (V467I)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: V467I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V467I

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 G A 8: 23,085,652 G167E probably damaging Het
Ano2 G A 6: 125,982,720 V648M probably damaging Het
Ap3b2 A G 7: 81,463,242 C954R unknown Het
Atp13a4 T G 16: 29,471,902 Y243S Het
Bend3 T G 10: 43,510,903 C431G probably damaging Het
Ccdc57 G A 11: 120,921,773 R52C probably damaging Het
Ccl22 T C 8: 94,746,991 W55R probably damaging Het
Ccnk A G 12: 108,186,499 Y25C probably damaging Het
Cntnap5a C T 1: 116,571,541 P1174S probably damaging Het
Copa T C 1: 172,118,979 probably null Het
Copg2 C T 6: 30,816,126 V425M probably benign Het
Dnah6 T C 6: 73,076,599 E2936G probably benign Het
Dnah6 T A 6: 73,195,681 T265S probably benign Het
Erc2 A G 14: 27,777,139 D324G probably benign Het
F11 T A 8: 45,248,607 H363L possibly damaging Het
F7 T C 8: 13,033,981 V222A probably benign Het
Fars2 A G 13: 36,410,110 D366G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flot2 A G 11: 78,059,195 I417V probably benign Het
Fmnl1 T C 11: 103,186,699 F295S probably damaging Het
Gpr89 G A 3: 96,905,189 T12I probably benign Het
Gprc6a T C 10: 51,631,274 D53G probably benign Het
Gtf2e1 T A 16: 37,522,851 I184F probably damaging Het
Gtf2h1 G A 7: 46,805,050 R152H probably benign Het
Haus3 A G 5: 34,154,091 F532L probably benign Het
Inpp4a A G 1: 37,368,439 probably benign Het
Klc4 A T 17: 46,642,154 L150Q possibly damaging Het
Lzts3 C T 2: 130,634,881 R549Q possibly damaging Het
Mbd5 T A 2: 49,278,879 L1354Q probably damaging Het
Mtus2 A G 5: 148,107,005 D801G probably damaging Het
Muc6 T A 7: 141,640,528 T1411S unknown Het
Nalcn C A 14: 123,317,024 G954C probably damaging Het
Nlrp9b G A 7: 20,024,061 E408K possibly damaging Het
Oaz3 A G 3: 94,435,127 L119P probably damaging Het
Olfr1361 A G 13: 21,659,207 F39L probably damaging Het
Pcdhgb5 T C 18: 37,732,187 V345A probably benign Het
Pdzph1 A T 17: 58,973,014 Y758N probably benign Het
Pea15a T A 1: 172,199,245 H65L probably damaging Het
Pigm T A 1: 172,377,957 I420N probably benign Het
Pign A G 1: 105,589,078 F580L probably benign Het
Pkhd1 T C 1: 20,537,420 probably benign Het
Plxnc1 T C 10: 94,813,243 N1225D probably benign Het
Rbbp6 G A 7: 122,990,324 D412N probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rtl1 A G 12: 109,592,715 Y897H possibly damaging Het
Scube2 A T 7: 109,809,176 F688Y probably benign Het
Sgol2b C A 8: 63,924,701 R1166L unknown Het
Slc12a2 G T 18: 57,914,266 probably benign Het
Smpdl3b T A 4: 132,738,401 H236L probably damaging Het
Spata9 C A 13: 75,977,547 probably benign Het
St6galnac4 A G 2: 32,587,655 probably benign Het
Stc2 T A 11: 31,369,777 N29I possibly damaging Het
Sun5 A T 2: 153,865,323 M145K possibly damaging Het
Tas2r106 T C 6: 131,678,055 I278V probably damaging Het
Trrap A G 5: 144,791,165 I565M probably damaging Het
Ttl A G 2: 129,068,933 K79R probably benign Het
Ttn A T 2: 76,907,377 Y4319N unknown Het
Usp28 T C 9: 49,026,882 L584P probably damaging Het
Wdr27 A G 17: 14,829,576 S777P probably benign Het
Wdr34 A T 2: 30,031,891 V486D probably damaging Het
Wee1 A G 7: 110,124,484 D202G probably benign Het
Wnt5a T C 14: 28,522,605 Y270H probably damaging Het
Zfp318 G A 17: 46,412,375 C1768Y probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTACGCTTCCTTTGGTGG -3'
(R):5'- TTGCTTTGCACGCACGTTG -3'

Sequencing Primer
(F):5'- TGATGAGACCCCAGGAGACATC -3'
(R):5'- GCTAGGCTCATTTATAGCCCGG -3'
Posted On2020-07-28