Incidental Mutation 'R8273:Ap3b2'
ID637846
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8273 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81463242 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 954 (C954R)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
Predicted Effect unknown
Transcript: ENSMUST00000082090
AA Change: C954R
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: C954R

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,450 V467I probably benign Het
Ank1 G A 8: 23,085,652 G167E probably damaging Het
Ano2 G A 6: 125,982,720 V648M probably damaging Het
Atp13a4 T G 16: 29,471,902 Y243S Het
Bend3 T G 10: 43,510,903 C431G probably damaging Het
Ccdc57 G A 11: 120,921,773 R52C probably damaging Het
Ccl22 T C 8: 94,746,991 W55R probably damaging Het
Ccnk A G 12: 108,186,499 Y25C probably damaging Het
Cntnap5a C T 1: 116,571,541 P1174S probably damaging Het
Copa T C 1: 172,118,979 probably null Het
Copg2 C T 6: 30,816,126 V425M probably benign Het
Dnah6 T C 6: 73,076,599 E2936G probably benign Het
Dnah6 T A 6: 73,195,681 T265S probably benign Het
Erc2 A G 14: 27,777,139 D324G probably benign Het
F11 T A 8: 45,248,607 H363L possibly damaging Het
F7 T C 8: 13,033,981 V222A probably benign Het
Fars2 A G 13: 36,410,110 D366G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flot2 A G 11: 78,059,195 I417V probably benign Het
Fmnl1 T C 11: 103,186,699 F295S probably damaging Het
Gpr89 G A 3: 96,905,189 T12I probably benign Het
Gprc6a T C 10: 51,631,274 D53G probably benign Het
Gtf2e1 T A 16: 37,522,851 I184F probably damaging Het
Gtf2h1 G A 7: 46,805,050 R152H probably benign Het
Haus3 A G 5: 34,154,091 F532L probably benign Het
Inpp4a A G 1: 37,368,439 probably benign Het
Klc4 A T 17: 46,642,154 L150Q possibly damaging Het
Lzts3 C T 2: 130,634,881 R549Q possibly damaging Het
Mbd5 T A 2: 49,278,879 L1354Q probably damaging Het
Mtus2 A G 5: 148,107,005 D801G probably damaging Het
Muc6 T A 7: 141,640,528 T1411S unknown Het
Nalcn C A 14: 123,317,024 G954C probably damaging Het
Nlrp9b G A 7: 20,024,061 E408K possibly damaging Het
Oaz3 A G 3: 94,435,127 L119P probably damaging Het
Olfr1361 A G 13: 21,659,207 F39L probably damaging Het
Pcdhgb5 T C 18: 37,732,187 V345A probably benign Het
Pdzph1 A T 17: 58,973,014 Y758N probably benign Het
Pea15a T A 1: 172,199,245 H65L probably damaging Het
Pigm T A 1: 172,377,957 I420N probably benign Het
Pign A G 1: 105,589,078 F580L probably benign Het
Pkhd1 T C 1: 20,537,420 probably benign Het
Plxnc1 T C 10: 94,813,243 N1225D probably benign Het
Rbbp6 G A 7: 122,990,324 D412N probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rtl1 A G 12: 109,592,715 Y897H possibly damaging Het
Scube2 A T 7: 109,809,176 F688Y probably benign Het
Sgol2b C A 8: 63,924,701 R1166L unknown Het
Slc12a2 G T 18: 57,914,266 probably benign Het
Smpdl3b T A 4: 132,738,401 H236L probably damaging Het
Spata9 C A 13: 75,977,547 probably benign Het
St6galnac4 A G 2: 32,587,655 probably benign Het
Stc2 T A 11: 31,369,777 N29I possibly damaging Het
Sun5 A T 2: 153,865,323 M145K possibly damaging Het
Tas2r106 T C 6: 131,678,055 I278V probably damaging Het
Trrap A G 5: 144,791,165 I565M probably damaging Het
Ttl A G 2: 129,068,933 K79R probably benign Het
Ttn A T 2: 76,907,377 Y4319N unknown Het
Usp28 T C 9: 49,026,882 L584P probably damaging Het
Wdr27 A G 17: 14,829,576 S777P probably benign Het
Wdr34 A T 2: 30,031,891 V486D probably damaging Het
Wee1 A G 7: 110,124,484 D202G probably benign Het
Wnt5a T C 14: 28,522,605 Y270H probably damaging Het
Zfp318 G A 17: 46,412,375 C1768Y probably damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAATGAGGCCAGCATCCAC -3'
(R):5'- ATGGAAGGCTGATGTGCTC -3'

Sequencing Primer
(F):5'- CATCTTATCTTGAGGCAGGGCAC -3'
(R):5'- CTCTGGTATGGGAGGGAGAC -3'
Posted On2020-07-28