Incidental Mutation 'R8273:Scube2'
ID637847
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Namesignal peptide, CUB domain, EGF-like 2
SynonymsICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R8273 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109798676-109865679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109809176 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 688 (F688Y)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
Predicted Effect probably benign
Transcript: ENSMUST00000007423
AA Change: F717Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: F717Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106728
AA Change: F591Y

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: F591Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
AA Change: F688Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: F688Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,450 V467I probably benign Het
Ank1 G A 8: 23,085,652 G167E probably damaging Het
Ano2 G A 6: 125,982,720 V648M probably damaging Het
Ap3b2 A G 7: 81,463,242 C954R unknown Het
Atp13a4 T G 16: 29,471,902 Y243S Het
Bend3 T G 10: 43,510,903 C431G probably damaging Het
Ccdc57 G A 11: 120,921,773 R52C probably damaging Het
Ccl22 T C 8: 94,746,991 W55R probably damaging Het
Ccnk A G 12: 108,186,499 Y25C probably damaging Het
Cntnap5a C T 1: 116,571,541 P1174S probably damaging Het
Copa T C 1: 172,118,979 probably null Het
Copg2 C T 6: 30,816,126 V425M probably benign Het
Dnah6 T C 6: 73,076,599 E2936G probably benign Het
Dnah6 T A 6: 73,195,681 T265S probably benign Het
Erc2 A G 14: 27,777,139 D324G probably benign Het
F11 T A 8: 45,248,607 H363L possibly damaging Het
F7 T C 8: 13,033,981 V222A probably benign Het
Fars2 A G 13: 36,410,110 D366G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flot2 A G 11: 78,059,195 I417V probably benign Het
Fmnl1 T C 11: 103,186,699 F295S probably damaging Het
Gpr89 G A 3: 96,905,189 T12I probably benign Het
Gprc6a T C 10: 51,631,274 D53G probably benign Het
Gtf2e1 T A 16: 37,522,851 I184F probably damaging Het
Gtf2h1 G A 7: 46,805,050 R152H probably benign Het
Haus3 A G 5: 34,154,091 F532L probably benign Het
Inpp4a A G 1: 37,368,439 probably benign Het
Klc4 A T 17: 46,642,154 L150Q possibly damaging Het
Lzts3 C T 2: 130,634,881 R549Q possibly damaging Het
Mbd5 T A 2: 49,278,879 L1354Q probably damaging Het
Mtus2 A G 5: 148,107,005 D801G probably damaging Het
Muc6 T A 7: 141,640,528 T1411S unknown Het
Nalcn C A 14: 123,317,024 G954C probably damaging Het
Nlrp9b G A 7: 20,024,061 E408K possibly damaging Het
Oaz3 A G 3: 94,435,127 L119P probably damaging Het
Olfr1361 A G 13: 21,659,207 F39L probably damaging Het
Pcdhgb5 T C 18: 37,732,187 V345A probably benign Het
Pdzph1 A T 17: 58,973,014 Y758N probably benign Het
Pea15a T A 1: 172,199,245 H65L probably damaging Het
Pigm T A 1: 172,377,957 I420N probably benign Het
Pign A G 1: 105,589,078 F580L probably benign Het
Pkhd1 T C 1: 20,537,420 probably benign Het
Plxnc1 T C 10: 94,813,243 N1225D probably benign Het
Rbbp6 G A 7: 122,990,324 D412N probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rtl1 A G 12: 109,592,715 Y897H possibly damaging Het
Sgol2b C A 8: 63,924,701 R1166L unknown Het
Slc12a2 G T 18: 57,914,266 probably benign Het
Smpdl3b T A 4: 132,738,401 H236L probably damaging Het
Spata9 C A 13: 75,977,547 probably benign Het
St6galnac4 A G 2: 32,587,655 probably benign Het
Stc2 T A 11: 31,369,777 N29I possibly damaging Het
Sun5 A T 2: 153,865,323 M145K possibly damaging Het
Tas2r106 T C 6: 131,678,055 I278V probably damaging Het
Trrap A G 5: 144,791,165 I565M probably damaging Het
Ttl A G 2: 129,068,933 K79R probably benign Het
Ttn A T 2: 76,907,377 Y4319N unknown Het
Usp28 T C 9: 49,026,882 L584P probably damaging Het
Wdr27 A G 17: 14,829,576 S777P probably benign Het
Wdr34 A T 2: 30,031,891 V486D probably damaging Het
Wee1 A G 7: 110,124,484 D202G probably benign Het
Wnt5a T C 14: 28,522,605 Y270H probably damaging Het
Zfp318 G A 17: 46,412,375 C1768Y probably damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGCACCAGACTCAATGG -3'
(R):5'- GCAAACCTGAGGCATTACCC -3'

Sequencing Primer
(F):5'- GGAACTCATTAGAGAATGGCATTCC -3'
(R):5'- CTCACTGATGTGTAAGCTGAAGTCAG -3'
Posted On2020-07-28