Incidental Mutation 'R8273:Scube2'
ID 637847
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703B1614Q5.1, Cegf1, ICRFP703N2430Q5.1, 4932442O19Rik
MMRRC Submission 067696-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.633) question?
Stock # R8273 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109397897-109464886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109408383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 688 (F688Y)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably benign
Transcript: ENSMUST00000007423
AA Change: F717Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: F717Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106728
AA Change: F591Y

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: F591Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
AA Change: F688Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: F688Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,772,211 (GRCm39) V467I probably benign Het
Ank1 G A 8: 23,575,668 (GRCm39) G167E probably damaging Het
Ano2 G A 6: 125,959,683 (GRCm39) V648M probably damaging Het
Ap3b2 A G 7: 81,112,990 (GRCm39) C954R unknown Het
Atp13a4 T G 16: 29,290,720 (GRCm39) Y243S Het
Bend3 T G 10: 43,386,899 (GRCm39) C431G probably damaging Het
Ccdc57 G A 11: 120,812,599 (GRCm39) R52C probably damaging Het
Ccl22 T C 8: 95,473,619 (GRCm39) W55R probably damaging Het
Ccnk A G 12: 108,152,758 (GRCm39) Y25C probably damaging Het
Cntnap5a C T 1: 116,499,271 (GRCm39) P1174S probably damaging Het
Copa T C 1: 171,946,546 (GRCm39) probably null Het
Copg2 C T 6: 30,793,061 (GRCm39) V425M probably benign Het
Dnah6 T C 6: 73,053,582 (GRCm39) E2936G probably benign Het
Dnah6 T A 6: 73,172,664 (GRCm39) T265S probably benign Het
Dync2i2 A T 2: 29,921,903 (GRCm39) V486D probably damaging Het
Erc2 A G 14: 27,499,096 (GRCm39) D324G probably benign Het
F11 T A 8: 45,701,644 (GRCm39) H363L possibly damaging Het
F7 T C 8: 13,083,981 (GRCm39) V222A probably benign Het
Fars2 A G 13: 36,594,093 (GRCm39) D366G probably damaging Het
Fbxl12 C A 9: 20,550,160 (GRCm39) R165L possibly damaging Het
Flot2 A G 11: 77,950,021 (GRCm39) I417V probably benign Het
Fmnl1 T C 11: 103,077,525 (GRCm39) F295S probably damaging Het
Gpr89 G A 3: 96,812,505 (GRCm39) T12I probably benign Het
Gprc6a T C 10: 51,507,370 (GRCm39) D53G probably benign Het
Gtf2e1 T A 16: 37,343,213 (GRCm39) I184F probably damaging Het
Gtf2h1 G A 7: 46,454,474 (GRCm39) R152H probably benign Het
Haus3 A G 5: 34,311,435 (GRCm39) F532L probably benign Het
Inpp4a A G 1: 37,407,520 (GRCm39) probably benign Het
Klc4 A T 17: 46,953,080 (GRCm39) L150Q possibly damaging Het
Lzts3 C T 2: 130,476,801 (GRCm39) R549Q possibly damaging Het
Mbd5 T A 2: 49,168,891 (GRCm39) L1354Q probably damaging Het
Mtus2 A G 5: 148,043,815 (GRCm39) D801G probably damaging Het
Muc6 T A 7: 141,226,795 (GRCm39) T1411S unknown Het
Nalcn C A 14: 123,554,436 (GRCm39) G954C probably damaging Het
Nlrp9b G A 7: 19,757,986 (GRCm39) E408K possibly damaging Het
Oaz3 A G 3: 94,342,434 (GRCm39) L119P probably damaging Het
Or2w6 A G 13: 21,843,377 (GRCm39) F39L probably damaging Het
Pcdhgb5 T C 18: 37,865,240 (GRCm39) V345A probably benign Het
Pdzph1 A T 17: 59,280,009 (GRCm39) Y758N probably benign Het
Pea15a T A 1: 172,026,812 (GRCm39) H65L probably damaging Het
Pigm T A 1: 172,205,524 (GRCm39) I420N probably benign Het
Pign A G 1: 105,516,803 (GRCm39) F580L probably benign Het
Pkhd1 T C 1: 20,607,644 (GRCm39) probably benign Het
Plxnc1 T C 10: 94,649,105 (GRCm39) N1225D probably benign Het
Rbbp6 G A 7: 122,589,547 (GRCm39) D412N probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rtl1 A G 12: 109,559,149 (GRCm39) Y897H possibly damaging Het
Sgo2b C A 8: 64,377,735 (GRCm39) R1166L unknown Het
Slc12a2 G T 18: 58,047,338 (GRCm39) probably benign Het
Smpdl3b T A 4: 132,465,712 (GRCm39) H236L probably damaging Het
Spata9 C A 13: 76,125,666 (GRCm39) probably benign Het
St6galnac4 A G 2: 32,477,667 (GRCm39) probably benign Het
Stc2 T A 11: 31,319,777 (GRCm39) N29I possibly damaging Het
Sun5 A T 2: 153,707,243 (GRCm39) M145K possibly damaging Het
Tas2r106 T C 6: 131,655,018 (GRCm39) I278V probably damaging Het
Trrap A G 5: 144,727,975 (GRCm39) I565M probably damaging Het
Ttl A G 2: 128,910,853 (GRCm39) K79R probably benign Het
Ttn A T 2: 76,737,721 (GRCm39) Y4319N unknown Het
Usp28 T C 9: 48,938,182 (GRCm39) L584P probably damaging Het
Wdr27 A G 17: 15,049,838 (GRCm39) S777P probably benign Het
Wee1 A G 7: 109,723,691 (GRCm39) D202G probably benign Het
Wnt5a T C 14: 28,244,562 (GRCm39) Y270H probably damaging Het
Zfp318 G A 17: 46,723,301 (GRCm39) C1768Y probably damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109,407,661 (GRCm39) missense probably damaging 1.00
IGL01608:Scube2 APN 7 109,442,461 (GRCm39) missense probably benign
IGL02080:Scube2 APN 7 109,451,685 (GRCm39) missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109,408,387 (GRCm39) missense probably benign 0.22
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0106:Scube2 UTSW 7 109,446,115 (GRCm39) splice site probably benign
R0230:Scube2 UTSW 7 109,423,971 (GRCm39) critical splice donor site probably null
R0255:Scube2 UTSW 7 109,424,079 (GRCm39) missense probably damaging 0.98
R0427:Scube2 UTSW 7 109,424,044 (GRCm39) missense probably benign 0.00
R0612:Scube2 UTSW 7 109,403,971 (GRCm39) splice site probably benign
R0658:Scube2 UTSW 7 109,436,327 (GRCm39) splice site probably benign
R0687:Scube2 UTSW 7 109,428,335 (GRCm39) missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1366:Scube2 UTSW 7 109,403,821 (GRCm39) missense probably damaging 1.00
R1635:Scube2 UTSW 7 109,442,421 (GRCm39) missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1972:Scube2 UTSW 7 109,408,421 (GRCm39) missense probably benign 0.16
R2080:Scube2 UTSW 7 109,407,712 (GRCm39) missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109,424,666 (GRCm39) missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109,403,908 (GRCm39) missense probably damaging 1.00
R2325:Scube2 UTSW 7 109,443,161 (GRCm39) missense probably damaging 1.00
R3723:Scube2 UTSW 7 109,407,613 (GRCm39) splice site probably benign
R3887:Scube2 UTSW 7 109,442,383 (GRCm39) splice site probably benign
R3946:Scube2 UTSW 7 109,456,797 (GRCm39) missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109,430,978 (GRCm39) missense probably benign 0.09
R4621:Scube2 UTSW 7 109,399,857 (GRCm39) missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109,409,920 (GRCm39) missense probably damaging 0.96
R4736:Scube2 UTSW 7 109,430,412 (GRCm39) missense probably benign 0.01
R5096:Scube2 UTSW 7 109,398,451 (GRCm39) utr 3 prime probably benign
R5266:Scube2 UTSW 7 109,408,437 (GRCm39) missense probably damaging 1.00
R5579:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R5669:Scube2 UTSW 7 109,424,646 (GRCm39) missense probably benign 0.04
R5838:Scube2 UTSW 7 109,407,651 (GRCm39) missense probably damaging 1.00
R5916:Scube2 UTSW 7 109,430,931 (GRCm39) missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109,432,220 (GRCm39) nonsense probably null
R6731:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R6785:Scube2 UTSW 7 109,409,824 (GRCm39) missense probably benign
R8197:Scube2 UTSW 7 109,407,684 (GRCm39) missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109,463,377 (GRCm39) missense probably benign 0.20
R8427:Scube2 UTSW 7 109,399,797 (GRCm39) missense probably damaging 1.00
R8882:Scube2 UTSW 7 109,451,680 (GRCm39) missense probably damaging 1.00
R9258:Scube2 UTSW 7 109,398,515 (GRCm39) missense probably damaging 1.00
R9428:Scube2 UTSW 7 109,428,345 (GRCm39) missense probably benign 0.32
R9476:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9510:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9709:Scube2 UTSW 7 109,430,971 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,442,408 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,437,334 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGCACCAGACTCAATGG -3'
(R):5'- GCAAACCTGAGGCATTACCC -3'

Sequencing Primer
(F):5'- GGAACTCATTAGAGAATGGCATTCC -3'
(R):5'- CTCACTGATGTGTAAGCTGAAGTCAG -3'
Posted On 2020-07-28