Incidental Mutation 'R8273:Gprc6a'
ID 637859
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 067696-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8273 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51507370 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: D53G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: D53G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,772,211 (GRCm39) V467I probably benign Het
Ank1 G A 8: 23,575,668 (GRCm39) G167E probably damaging Het
Ano2 G A 6: 125,959,683 (GRCm39) V648M probably damaging Het
Ap3b2 A G 7: 81,112,990 (GRCm39) C954R unknown Het
Atp13a4 T G 16: 29,290,720 (GRCm39) Y243S Het
Bend3 T G 10: 43,386,899 (GRCm39) C431G probably damaging Het
Ccdc57 G A 11: 120,812,599 (GRCm39) R52C probably damaging Het
Ccl22 T C 8: 95,473,619 (GRCm39) W55R probably damaging Het
Ccnk A G 12: 108,152,758 (GRCm39) Y25C probably damaging Het
Cntnap5a C T 1: 116,499,271 (GRCm39) P1174S probably damaging Het
Copa T C 1: 171,946,546 (GRCm39) probably null Het
Copg2 C T 6: 30,793,061 (GRCm39) V425M probably benign Het
Dnah6 T A 6: 73,172,664 (GRCm39) T265S probably benign Het
Dnah6 T C 6: 73,053,582 (GRCm39) E2936G probably benign Het
Dync2i2 A T 2: 29,921,903 (GRCm39) V486D probably damaging Het
Erc2 A G 14: 27,499,096 (GRCm39) D324G probably benign Het
F11 T A 8: 45,701,644 (GRCm39) H363L possibly damaging Het
F7 T C 8: 13,083,981 (GRCm39) V222A probably benign Het
Fars2 A G 13: 36,594,093 (GRCm39) D366G probably damaging Het
Fbxl12 C A 9: 20,550,160 (GRCm39) R165L possibly damaging Het
Flot2 A G 11: 77,950,021 (GRCm39) I417V probably benign Het
Fmnl1 T C 11: 103,077,525 (GRCm39) F295S probably damaging Het
Gpr89 G A 3: 96,812,505 (GRCm39) T12I probably benign Het
Gtf2e1 T A 16: 37,343,213 (GRCm39) I184F probably damaging Het
Gtf2h1 G A 7: 46,454,474 (GRCm39) R152H probably benign Het
Haus3 A G 5: 34,311,435 (GRCm39) F532L probably benign Het
Inpp4a A G 1: 37,407,520 (GRCm39) probably benign Het
Klc4 A T 17: 46,953,080 (GRCm39) L150Q possibly damaging Het
Lzts3 C T 2: 130,476,801 (GRCm39) R549Q possibly damaging Het
Mbd5 T A 2: 49,168,891 (GRCm39) L1354Q probably damaging Het
Mtus2 A G 5: 148,043,815 (GRCm39) D801G probably damaging Het
Muc6 T A 7: 141,226,795 (GRCm39) T1411S unknown Het
Nalcn C A 14: 123,554,436 (GRCm39) G954C probably damaging Het
Nlrp9b G A 7: 19,757,986 (GRCm39) E408K possibly damaging Het
Oaz3 A G 3: 94,342,434 (GRCm39) L119P probably damaging Het
Or2w6 A G 13: 21,843,377 (GRCm39) F39L probably damaging Het
Pcdhgb5 T C 18: 37,865,240 (GRCm39) V345A probably benign Het
Pdzph1 A T 17: 59,280,009 (GRCm39) Y758N probably benign Het
Pea15a T A 1: 172,026,812 (GRCm39) H65L probably damaging Het
Pigm T A 1: 172,205,524 (GRCm39) I420N probably benign Het
Pign A G 1: 105,516,803 (GRCm39) F580L probably benign Het
Pkhd1 T C 1: 20,607,644 (GRCm39) probably benign Het
Plxnc1 T C 10: 94,649,105 (GRCm39) N1225D probably benign Het
Rbbp6 G A 7: 122,589,547 (GRCm39) D412N probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rtl1 A G 12: 109,559,149 (GRCm39) Y897H possibly damaging Het
Scube2 A T 7: 109,408,383 (GRCm39) F688Y probably benign Het
Sgo2b C A 8: 64,377,735 (GRCm39) R1166L unknown Het
Slc12a2 G T 18: 58,047,338 (GRCm39) probably benign Het
Smpdl3b T A 4: 132,465,712 (GRCm39) H236L probably damaging Het
Spata9 C A 13: 76,125,666 (GRCm39) probably benign Het
St6galnac4 A G 2: 32,477,667 (GRCm39) probably benign Het
Stc2 T A 11: 31,319,777 (GRCm39) N29I possibly damaging Het
Sun5 A T 2: 153,707,243 (GRCm39) M145K possibly damaging Het
Tas2r106 T C 6: 131,655,018 (GRCm39) I278V probably damaging Het
Trrap A G 5: 144,727,975 (GRCm39) I565M probably damaging Het
Ttl A G 2: 128,910,853 (GRCm39) K79R probably benign Het
Ttn A T 2: 76,737,721 (GRCm39) Y4319N unknown Het
Usp28 T C 9: 48,938,182 (GRCm39) L584P probably damaging Het
Wdr27 A G 17: 15,049,838 (GRCm39) S777P probably benign Het
Wee1 A G 7: 109,723,691 (GRCm39) D202G probably benign Het
Wnt5a T C 14: 28,244,562 (GRCm39) Y270H probably damaging Het
Zfp318 G A 17: 46,723,301 (GRCm39) C1768Y probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCTCTGCGCTTGGAAG -3'
(R):5'- TGAATGGCTCTTAATAACCCTCATG -3'

Sequencing Primer
(F):5'- TGGAAGCTGATTACACATATAGGAC -3'
(R):5'- GGCTCTTAATAACCCTCATGAACTG -3'
Posted On 2020-07-28