Incidental Mutation 'R8273:Erc2'
ID 637869
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene Name ELKS/RAB6-interacting/CAST family member 2
Synonyms D14Ertd171e, ELKS2alpha, CAST
MMRRC Submission 067696-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8273 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 27344385-28200494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27499096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 324 (D324G)
Ref Sequence ENSEMBL: ENSMUSP00000087773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000211087] [ENSMUST00000211145]
AlphaFold Q6PH08
Predicted Effect probably benign
Transcript: ENSMUST00000090302
AA Change: D324G

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: D324G

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210135
AA Change: D332G

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000211087
AA Change: D324G

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000211145
AA Change: D324G

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,772,211 (GRCm39) V467I probably benign Het
Ank1 G A 8: 23,575,668 (GRCm39) G167E probably damaging Het
Ano2 G A 6: 125,959,683 (GRCm39) V648M probably damaging Het
Ap3b2 A G 7: 81,112,990 (GRCm39) C954R unknown Het
Atp13a4 T G 16: 29,290,720 (GRCm39) Y243S Het
Bend3 T G 10: 43,386,899 (GRCm39) C431G probably damaging Het
Ccdc57 G A 11: 120,812,599 (GRCm39) R52C probably damaging Het
Ccl22 T C 8: 95,473,619 (GRCm39) W55R probably damaging Het
Ccnk A G 12: 108,152,758 (GRCm39) Y25C probably damaging Het
Cntnap5a C T 1: 116,499,271 (GRCm39) P1174S probably damaging Het
Copa T C 1: 171,946,546 (GRCm39) probably null Het
Copg2 C T 6: 30,793,061 (GRCm39) V425M probably benign Het
Dnah6 T A 6: 73,172,664 (GRCm39) T265S probably benign Het
Dnah6 T C 6: 73,053,582 (GRCm39) E2936G probably benign Het
Dync2i2 A T 2: 29,921,903 (GRCm39) V486D probably damaging Het
F11 T A 8: 45,701,644 (GRCm39) H363L possibly damaging Het
F7 T C 8: 13,083,981 (GRCm39) V222A probably benign Het
Fars2 A G 13: 36,594,093 (GRCm39) D366G probably damaging Het
Fbxl12 C A 9: 20,550,160 (GRCm39) R165L possibly damaging Het
Flot2 A G 11: 77,950,021 (GRCm39) I417V probably benign Het
Fmnl1 T C 11: 103,077,525 (GRCm39) F295S probably damaging Het
Gpr89 G A 3: 96,812,505 (GRCm39) T12I probably benign Het
Gprc6a T C 10: 51,507,370 (GRCm39) D53G probably benign Het
Gtf2e1 T A 16: 37,343,213 (GRCm39) I184F probably damaging Het
Gtf2h1 G A 7: 46,454,474 (GRCm39) R152H probably benign Het
Haus3 A G 5: 34,311,435 (GRCm39) F532L probably benign Het
Inpp4a A G 1: 37,407,520 (GRCm39) probably benign Het
Klc4 A T 17: 46,953,080 (GRCm39) L150Q possibly damaging Het
Lzts3 C T 2: 130,476,801 (GRCm39) R549Q possibly damaging Het
Mbd5 T A 2: 49,168,891 (GRCm39) L1354Q probably damaging Het
Mtus2 A G 5: 148,043,815 (GRCm39) D801G probably damaging Het
Muc6 T A 7: 141,226,795 (GRCm39) T1411S unknown Het
Nalcn C A 14: 123,554,436 (GRCm39) G954C probably damaging Het
Nlrp9b G A 7: 19,757,986 (GRCm39) E408K possibly damaging Het
Oaz3 A G 3: 94,342,434 (GRCm39) L119P probably damaging Het
Or2w6 A G 13: 21,843,377 (GRCm39) F39L probably damaging Het
Pcdhgb5 T C 18: 37,865,240 (GRCm39) V345A probably benign Het
Pdzph1 A T 17: 59,280,009 (GRCm39) Y758N probably benign Het
Pea15a T A 1: 172,026,812 (GRCm39) H65L probably damaging Het
Pigm T A 1: 172,205,524 (GRCm39) I420N probably benign Het
Pign A G 1: 105,516,803 (GRCm39) F580L probably benign Het
Pkhd1 T C 1: 20,607,644 (GRCm39) probably benign Het
Plxnc1 T C 10: 94,649,105 (GRCm39) N1225D probably benign Het
Rbbp6 G A 7: 122,589,547 (GRCm39) D412N probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rtl1 A G 12: 109,559,149 (GRCm39) Y897H possibly damaging Het
Scube2 A T 7: 109,408,383 (GRCm39) F688Y probably benign Het
Sgo2b C A 8: 64,377,735 (GRCm39) R1166L unknown Het
Slc12a2 G T 18: 58,047,338 (GRCm39) probably benign Het
Smpdl3b T A 4: 132,465,712 (GRCm39) H236L probably damaging Het
Spata9 C A 13: 76,125,666 (GRCm39) probably benign Het
St6galnac4 A G 2: 32,477,667 (GRCm39) probably benign Het
Stc2 T A 11: 31,319,777 (GRCm39) N29I possibly damaging Het
Sun5 A T 2: 153,707,243 (GRCm39) M145K possibly damaging Het
Tas2r106 T C 6: 131,655,018 (GRCm39) I278V probably damaging Het
Trrap A G 5: 144,727,975 (GRCm39) I565M probably damaging Het
Ttl A G 2: 128,910,853 (GRCm39) K79R probably benign Het
Ttn A T 2: 76,737,721 (GRCm39) Y4319N unknown Het
Usp28 T C 9: 48,938,182 (GRCm39) L584P probably damaging Het
Wdr27 A G 17: 15,049,838 (GRCm39) S777P probably benign Het
Wee1 A G 7: 109,723,691 (GRCm39) D202G probably benign Het
Wnt5a T C 14: 28,244,562 (GRCm39) Y270H probably damaging Het
Zfp318 G A 17: 46,723,301 (GRCm39) C1768Y probably damaging Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 27,762,478 (GRCm39) missense probably damaging 0.98
IGL01862:Erc2 APN 14 27,993,526 (GRCm39) splice site probably benign
IGL01906:Erc2 APN 14 27,863,263 (GRCm39) missense probably damaging 0.99
IGL02177:Erc2 APN 14 27,620,580 (GRCm39) missense probably benign 0.00
IGL02481:Erc2 APN 14 27,375,028 (GRCm39) missense probably damaging 1.00
IGL02483:Erc2 APN 14 27,375,028 (GRCm39) missense probably damaging 1.00
IGL02623:Erc2 APN 14 27,498,937 (GRCm39) missense probably damaging 1.00
IGL03252:Erc2 APN 14 28,197,606 (GRCm39) utr 3 prime probably benign
IGL03378:Erc2 APN 14 27,733,680 (GRCm39) missense probably damaging 1.00
lobe UTSW 14 28,039,208 (GRCm39) missense probably damaging 0.96
R0091:Erc2 UTSW 14 27,498,781 (GRCm39) critical splice acceptor site probably null
R0309:Erc2 UTSW 14 27,863,182 (GRCm39) missense probably damaging 0.98
R0357:Erc2 UTSW 14 27,498,979 (GRCm39) missense probably damaging 0.99
R0378:Erc2 UTSW 14 27,733,651 (GRCm39) missense probably damaging 1.00
R0550:Erc2 UTSW 14 27,993,608 (GRCm39) missense possibly damaging 0.74
R0815:Erc2 UTSW 14 27,747,105 (GRCm39) missense probably benign 0.04
R0863:Erc2 UTSW 14 27,747,105 (GRCm39) missense probably benign 0.04
R1121:Erc2 UTSW 14 28,197,612 (GRCm39) utr 3 prime probably benign
R1164:Erc2 UTSW 14 28,024,929 (GRCm39) missense probably damaging 0.99
R1498:Erc2 UTSW 14 28,024,855 (GRCm39) missense probably benign 0.27
R1500:Erc2 UTSW 14 27,993,617 (GRCm39) missense probably damaging 0.98
R1555:Erc2 UTSW 14 27,733,622 (GRCm39) missense probably damaging 0.99
R1894:Erc2 UTSW 14 27,863,185 (GRCm39) missense probably damaging 0.99
R1950:Erc2 UTSW 14 27,634,857 (GRCm39) missense probably damaging 0.99
R1991:Erc2 UTSW 14 27,733,593 (GRCm39) missense probably benign 0.34
R2698:Erc2 UTSW 14 27,993,662 (GRCm39) missense probably benign 0.06
R2847:Erc2 UTSW 14 27,762,445 (GRCm39) missense probably damaging 0.97
R3015:Erc2 UTSW 14 27,733,732 (GRCm39) critical splice donor site probably null
R3612:Erc2 UTSW 14 27,499,134 (GRCm39) missense possibly damaging 0.69
R3759:Erc2 UTSW 14 27,747,120 (GRCm39) missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R3858:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R3859:Erc2 UTSW 14 28,197,599 (GRCm39) utr 3 prime probably benign
R4556:Erc2 UTSW 14 28,024,861 (GRCm39) missense probably damaging 1.00
R4739:Erc2 UTSW 14 27,498,838 (GRCm39) missense probably damaging 1.00
R4898:Erc2 UTSW 14 27,375,285 (GRCm39) missense probably damaging 1.00
R5068:Erc2 UTSW 14 28,024,900 (GRCm39) missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27,374,829 (GRCm39) missense probably benign 0.40
R5418:Erc2 UTSW 14 27,688,467 (GRCm39) missense probably benign 0.14
R5741:Erc2 UTSW 14 28,024,826 (GRCm39) splice site probably null
R5819:Erc2 UTSW 14 27,863,326 (GRCm39) missense probably damaging 0.97
R5930:Erc2 UTSW 14 27,498,815 (GRCm39) missense probably damaging 0.99
R6073:Erc2 UTSW 14 27,733,593 (GRCm39) missense probably benign 0.00
R6150:Erc2 UTSW 14 27,863,248 (GRCm39) missense probably damaging 0.97
R6182:Erc2 UTSW 14 28,039,210 (GRCm39) missense probably damaging 0.99
R6188:Erc2 UTSW 14 28,039,208 (GRCm39) missense probably damaging 0.96
R6267:Erc2 UTSW 14 27,802,112 (GRCm39) missense probably damaging 1.00
R6296:Erc2 UTSW 14 27,802,112 (GRCm39) missense probably damaging 1.00
R6730:Erc2 UTSW 14 27,620,524 (GRCm39) missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27,620,553 (GRCm39) missense probably damaging 1.00
R7095:Erc2 UTSW 14 27,620,550 (GRCm39) missense probably damaging 0.99
R7221:Erc2 UTSW 14 27,375,115 (GRCm39) missense probably damaging 0.97
R7365:Erc2 UTSW 14 27,762,346 (GRCm39) missense probably damaging 1.00
R7454:Erc2 UTSW 14 28,024,948 (GRCm39) missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27,598,161 (GRCm39) critical splice donor site probably null
R7784:Erc2 UTSW 14 27,620,551 (GRCm39) missense probably damaging 0.96
R7890:Erc2 UTSW 14 27,762,298 (GRCm39) critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27,499,165 (GRCm39) missense probably damaging 1.00
R8031:Erc2 UTSW 14 27,733,649 (GRCm39) missense probably damaging 0.99
R8206:Erc2 UTSW 14 28,024,972 (GRCm39) splice site probably null
R8304:Erc2 UTSW 14 27,375,122 (GRCm39) missense probably damaging 0.99
R8387:Erc2 UTSW 14 27,375,253 (GRCm39) missense possibly damaging 0.92
R8751:Erc2 UTSW 14 27,802,145 (GRCm39) missense possibly damaging 0.78
R8851:Erc2 UTSW 14 28,039,216 (GRCm39) missense probably null 0.99
R9130:Erc2 UTSW 14 27,751,418 (GRCm39) missense probably benign 0.25
R9292:Erc2 UTSW 14 27,498,799 (GRCm39) missense probably damaging 1.00
R9441:Erc2 UTSW 14 27,802,114 (GRCm39) missense possibly damaging 0.58
R9452:Erc2 UTSW 14 27,733,690 (GRCm39) missense probably damaging 1.00
R9529:Erc2 UTSW 14 28,197,723 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCGAGCACTTCACCATTG -3'
(R):5'- TTGAGACTGTAGACATTTTCCAACC -3'

Sequencing Primer
(F):5'- CTTCACCATTGAGCTGACAGAGG -3'
(R):5'- GACATTTTCCAACCTGTGAAAGAGC -3'
Posted On 2020-07-28