Incidental Mutation 'R8273:Gtf2e1'
ID637873
Institutional Source Beutler Lab
Gene Symbol Gtf2e1
Ensembl Gene ENSMUSG00000022828
Gene Namegeneral transcription factor II E, polypeptide 1 (alpha subunit)
SynonymsTFIIE-A, FE, 2610024P03Rik, 56kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R8273 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location37509790-37539789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37522851 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 184 (I184F)
Ref Sequence ENSEMBL: ENSMUSP00000023525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023525]
Predicted Effect probably damaging
Transcript: ENSMUST00000023525
AA Change: I184F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023525
Gene: ENSMUSG00000022828
AA Change: I184F

DomainStartEndE-ValueType
TFIIE 28 175 2.69e-74 SMART
low complexity region 221 233 N/A INTRINSIC
low complexity region 332 351 N/A INTRINSIC
Pfam:TFIIE-A_C 354 440 9.9e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,450 V467I probably benign Het
Ank1 G A 8: 23,085,652 G167E probably damaging Het
Ano2 G A 6: 125,982,720 V648M probably damaging Het
Ap3b2 A G 7: 81,463,242 C954R unknown Het
Atp13a4 T G 16: 29,471,902 Y243S Het
Bend3 T G 10: 43,510,903 C431G probably damaging Het
Ccdc57 G A 11: 120,921,773 R52C probably damaging Het
Ccl22 T C 8: 94,746,991 W55R probably damaging Het
Ccnk A G 12: 108,186,499 Y25C probably damaging Het
Cntnap5a C T 1: 116,571,541 P1174S probably damaging Het
Copa T C 1: 172,118,979 probably null Het
Copg2 C T 6: 30,816,126 V425M probably benign Het
Dnah6 T C 6: 73,076,599 E2936G probably benign Het
Dnah6 T A 6: 73,195,681 T265S probably benign Het
Erc2 A G 14: 27,777,139 D324G probably benign Het
F11 T A 8: 45,248,607 H363L possibly damaging Het
F7 T C 8: 13,033,981 V222A probably benign Het
Fars2 A G 13: 36,410,110 D366G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flot2 A G 11: 78,059,195 I417V probably benign Het
Fmnl1 T C 11: 103,186,699 F295S probably damaging Het
Gpr89 G A 3: 96,905,189 T12I probably benign Het
Gprc6a T C 10: 51,631,274 D53G probably benign Het
Gtf2h1 G A 7: 46,805,050 R152H probably benign Het
Haus3 A G 5: 34,154,091 F532L probably benign Het
Inpp4a A G 1: 37,368,439 probably benign Het
Klc4 A T 17: 46,642,154 L150Q possibly damaging Het
Lzts3 C T 2: 130,634,881 R549Q possibly damaging Het
Mbd5 T A 2: 49,278,879 L1354Q probably damaging Het
Mtus2 A G 5: 148,107,005 D801G probably damaging Het
Muc6 T A 7: 141,640,528 T1411S unknown Het
Nalcn C A 14: 123,317,024 G954C probably damaging Het
Nlrp9b G A 7: 20,024,061 E408K possibly damaging Het
Oaz3 A G 3: 94,435,127 L119P probably damaging Het
Olfr1361 A G 13: 21,659,207 F39L probably damaging Het
Pcdhgb5 T C 18: 37,732,187 V345A probably benign Het
Pdzph1 A T 17: 58,973,014 Y758N probably benign Het
Pea15a T A 1: 172,199,245 H65L probably damaging Het
Pigm T A 1: 172,377,957 I420N probably benign Het
Pign A G 1: 105,589,078 F580L probably benign Het
Pkhd1 T C 1: 20,537,420 probably benign Het
Plxnc1 T C 10: 94,813,243 N1225D probably benign Het
Rbbp6 G A 7: 122,990,324 D412N probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rtl1 A G 12: 109,592,715 Y897H possibly damaging Het
Scube2 A T 7: 109,809,176 F688Y probably benign Het
Sgol2b C A 8: 63,924,701 R1166L unknown Het
Slc12a2 G T 18: 57,914,266 probably benign Het
Smpdl3b T A 4: 132,738,401 H236L probably damaging Het
Spata9 C A 13: 75,977,547 probably benign Het
St6galnac4 A G 2: 32,587,655 probably benign Het
Stc2 T A 11: 31,369,777 N29I possibly damaging Het
Sun5 A T 2: 153,865,323 M145K possibly damaging Het
Tas2r106 T C 6: 131,678,055 I278V probably damaging Het
Trrap A G 5: 144,791,165 I565M probably damaging Het
Ttl A G 2: 129,068,933 K79R probably benign Het
Ttn A T 2: 76,907,377 Y4319N unknown Het
Usp28 T C 9: 49,026,882 L584P probably damaging Het
Wdr27 A G 17: 14,829,576 S777P probably benign Het
Wdr34 A T 2: 30,031,891 V486D probably damaging Het
Wee1 A G 7: 110,124,484 D202G probably benign Het
Wnt5a T C 14: 28,522,605 Y270H probably damaging Het
Zfp318 G A 17: 46,412,375 C1768Y probably damaging Het
Other mutations in Gtf2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Gtf2e1 APN 16 37535920 missense possibly damaging 0.90
IGL00966:Gtf2e1 APN 16 37515730 missense probably benign
IGL03372:Gtf2e1 APN 16 37535715 unclassified probably benign
R2202:Gtf2e1 UTSW 16 37511542 missense possibly damaging 0.49
R2203:Gtf2e1 UTSW 16 37511542 missense possibly damaging 0.49
R5262:Gtf2e1 UTSW 16 37535931 missense probably damaging 0.96
R6457:Gtf2e1 UTSW 16 37536336 splice site probably null
R6522:Gtf2e1 UTSW 16 37511454 missense possibly damaging 0.47
R7165:Gtf2e1 UTSW 16 37535866 missense probably damaging 1.00
R7297:Gtf2e1 UTSW 16 37536065 missense probably damaging 1.00
R8123:Gtf2e1 UTSW 16 37515743 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCTCTGTGACATCTGAGTCTG -3'
(R):5'- GTGTTAGGAGGTTTTACCCAAAC -3'

Sequencing Primer
(F):5'- GAGTCTGTAGTCTCCTGGTAAATAC -3'
(R):5'- CAAACATTGGAGGCGTGGAG -3'
Posted On2020-07-28