Incidental Mutation 'R8273:Pdzph1'
ID 637878
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 067696-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8273 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59280009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 758 (Y758N)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: Y758N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: Y758N

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,772,211 (GRCm39) V467I probably benign Het
Ank1 G A 8: 23,575,668 (GRCm39) G167E probably damaging Het
Ano2 G A 6: 125,959,683 (GRCm39) V648M probably damaging Het
Ap3b2 A G 7: 81,112,990 (GRCm39) C954R unknown Het
Atp13a4 T G 16: 29,290,720 (GRCm39) Y243S Het
Bend3 T G 10: 43,386,899 (GRCm39) C431G probably damaging Het
Ccdc57 G A 11: 120,812,599 (GRCm39) R52C probably damaging Het
Ccl22 T C 8: 95,473,619 (GRCm39) W55R probably damaging Het
Ccnk A G 12: 108,152,758 (GRCm39) Y25C probably damaging Het
Cntnap5a C T 1: 116,499,271 (GRCm39) P1174S probably damaging Het
Copa T C 1: 171,946,546 (GRCm39) probably null Het
Copg2 C T 6: 30,793,061 (GRCm39) V425M probably benign Het
Dnah6 T A 6: 73,172,664 (GRCm39) T265S probably benign Het
Dnah6 T C 6: 73,053,582 (GRCm39) E2936G probably benign Het
Dync2i2 A T 2: 29,921,903 (GRCm39) V486D probably damaging Het
Erc2 A G 14: 27,499,096 (GRCm39) D324G probably benign Het
F11 T A 8: 45,701,644 (GRCm39) H363L possibly damaging Het
F7 T C 8: 13,083,981 (GRCm39) V222A probably benign Het
Fars2 A G 13: 36,594,093 (GRCm39) D366G probably damaging Het
Fbxl12 C A 9: 20,550,160 (GRCm39) R165L possibly damaging Het
Flot2 A G 11: 77,950,021 (GRCm39) I417V probably benign Het
Fmnl1 T C 11: 103,077,525 (GRCm39) F295S probably damaging Het
Gpr89 G A 3: 96,812,505 (GRCm39) T12I probably benign Het
Gprc6a T C 10: 51,507,370 (GRCm39) D53G probably benign Het
Gtf2e1 T A 16: 37,343,213 (GRCm39) I184F probably damaging Het
Gtf2h1 G A 7: 46,454,474 (GRCm39) R152H probably benign Het
Haus3 A G 5: 34,311,435 (GRCm39) F532L probably benign Het
Inpp4a A G 1: 37,407,520 (GRCm39) probably benign Het
Klc4 A T 17: 46,953,080 (GRCm39) L150Q possibly damaging Het
Lzts3 C T 2: 130,476,801 (GRCm39) R549Q possibly damaging Het
Mbd5 T A 2: 49,168,891 (GRCm39) L1354Q probably damaging Het
Mtus2 A G 5: 148,043,815 (GRCm39) D801G probably damaging Het
Muc6 T A 7: 141,226,795 (GRCm39) T1411S unknown Het
Nalcn C A 14: 123,554,436 (GRCm39) G954C probably damaging Het
Nlrp9b G A 7: 19,757,986 (GRCm39) E408K possibly damaging Het
Oaz3 A G 3: 94,342,434 (GRCm39) L119P probably damaging Het
Or2w6 A G 13: 21,843,377 (GRCm39) F39L probably damaging Het
Pcdhgb5 T C 18: 37,865,240 (GRCm39) V345A probably benign Het
Pea15a T A 1: 172,026,812 (GRCm39) H65L probably damaging Het
Pigm T A 1: 172,205,524 (GRCm39) I420N probably benign Het
Pign A G 1: 105,516,803 (GRCm39) F580L probably benign Het
Pkhd1 T C 1: 20,607,644 (GRCm39) probably benign Het
Plxnc1 T C 10: 94,649,105 (GRCm39) N1225D probably benign Het
Rbbp6 G A 7: 122,589,547 (GRCm39) D412N probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rtl1 A G 12: 109,559,149 (GRCm39) Y897H possibly damaging Het
Scube2 A T 7: 109,408,383 (GRCm39) F688Y probably benign Het
Sgo2b C A 8: 64,377,735 (GRCm39) R1166L unknown Het
Slc12a2 G T 18: 58,047,338 (GRCm39) probably benign Het
Smpdl3b T A 4: 132,465,712 (GRCm39) H236L probably damaging Het
Spata9 C A 13: 76,125,666 (GRCm39) probably benign Het
St6galnac4 A G 2: 32,477,667 (GRCm39) probably benign Het
Stc2 T A 11: 31,319,777 (GRCm39) N29I possibly damaging Het
Sun5 A T 2: 153,707,243 (GRCm39) M145K possibly damaging Het
Tas2r106 T C 6: 131,655,018 (GRCm39) I278V probably damaging Het
Trrap A G 5: 144,727,975 (GRCm39) I565M probably damaging Het
Ttl A G 2: 128,910,853 (GRCm39) K79R probably benign Het
Ttn A T 2: 76,737,721 (GRCm39) Y4319N unknown Het
Usp28 T C 9: 48,938,182 (GRCm39) L584P probably damaging Het
Wdr27 A G 17: 15,049,838 (GRCm39) S777P probably benign Het
Wee1 A G 7: 109,723,691 (GRCm39) D202G probably benign Het
Wnt5a T C 14: 28,244,562 (GRCm39) Y270H probably damaging Het
Zfp318 G A 17: 46,723,301 (GRCm39) C1768Y probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCTGATAGATTCTTCTTC -3'
(R):5'- TGTAGGACACACTACAGAAAAGCTG -3'

Sequencing Primer
(F):5'- ACTCTAAAATGCTTAGCACATCTTG -3'
(R):5'- TGTTTCTTATTGATAAGACACTAGCC -3'
Posted On 2020-07-28