Mutagenetix > Incidental Mutation

Incidental Mutation 'R0726:Sh3pxd2a'

63788

Institutional Source

Beutler Lab

Gene Symbol

Sh3pxd2a

Ensembl Gene

ENSMUSG00000053617

Gene Name

SH3 and PX domains 2A

Synonyms

Tks5, Fish, Sh3md1, 2310014D11Rik

MMRRC Submission

038908-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0726 (G1)

Quality Score

130

Status

Validated

Chromosome

Chromosomal Location

47260174-47464411 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 47268762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 506 (E506K)

Ref Sequence

ENSEMBL: ENSMUSP00000107430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]

AlphaFold

O89032

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081619
AA Change: E534K

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: E534K

Domain	Start	End	E-Value	Type
PX	3	124	3.6e-32	SMART
SH3	169	224	3.24e-16	SMART
low complexity region	242	254	N/A	INTRINSIC
SH3	269	324	6.49e-16	SMART
low complexity region	360	371	N/A	INTRINSIC
SH3	450	505	4.49e-10	SMART
low complexity region	519	537	N/A	INTRINSIC
low complexity region	632	652	N/A	INTRINSIC
low complexity region	654	676	N/A	INTRINSIC
low complexity region	685	709	N/A	INTRINSIC
SH3	836	891	2.41e-10	SMART
SH3	1066	1124	3.85e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111800
AA Change: E506K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: E506K

Domain	Start	End	E-Value	Type
PX	3	124	3.6e-32	SMART
SH3	169	224	3.24e-16	SMART
SH3	241	296	6.49e-16	SMART
low complexity region	332	343	N/A	INTRINSIC
SH3	422	477	4.49e-10	SMART
low complexity region	491	509	N/A	INTRINSIC
low complexity region	604	624	N/A	INTRINSIC
low complexity region	626	648	N/A	INTRINSIC
low complexity region	657	681	N/A	INTRINSIC
SH3	808	863	2.41e-10	SMART
SH3	1038	1096	3.85e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183658

Meta Mutation Damage Score

0.1626

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.1%
20x: 89.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg12	T	C	15: 88,806,647	Y256C	probably damaging	Het
Alox15	T	A	11: 70,350,195	D160V	probably damaging	Het
Aox2	T	C	1: 58,334,782		probably benign	Het
Bbs9	G	T	9: 22,793,823	A729S	probably damaging	Het
Bmp2k	T	A	5: 97,087,494		probably benign	Het
Braf	C	T	6: 39,662,148	R223Q	possibly damaging	Het
Cd101	A	T	3: 101,020,622	S48T	possibly damaging	Het
Cdh9	T	G	15: 16,831,044	D322E	probably benign	Het
Col28a1	C	T	6: 8,014,495		probably null	Het
Cpxm1	G	A	2: 130,390,939	R712W	probably damaging	Het
Csnk1g1	T	C	9: 66,032,355		probably benign	Het
Cyp2d37-ps	A	C	15: 82,690,449		noncoding transcript	Het
Cyth3	T	C	5: 143,692,642	V115A	probably benign	Het
Dnah9	C	T	11: 65,965,681	V2885M	probably damaging	Het
Dock9	G	T	14: 121,651,768	Y326*	probably null	Het
Espl1	T	C	15: 102,322,598	I1844T	probably benign	Het
Fam105a	A	T	15: 27,656,947	I338N	probably damaging	Het
Fam20a	T	A	11: 109,677,194	N357Y	probably damaging	Het
Fancc	C	A	13: 63,323,411	R385L	probably benign	Het
Foxe3	A	T	4: 114,925,250	L255H	unknown	Het
Frem2	T	C	3: 53,519,626	D2967G	possibly damaging	Het
Gabra6	T	G	11: 42,315,127	T301P	probably damaging	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gm498	A	G	7: 143,871,761	D49G	probably damaging	Het
Grm4	T	A	17: 27,438,438		probably benign	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Kcnj9	G	A	1: 172,325,921	S212F	probably damaging	Het
Kif15	C	A	9: 122,959,928	H62N	probably benign	Het
Kptn	A	G	7: 16,120,722	D106G	probably damaging	Het
Krtap13-1	T	A	16: 88,729,304	S139T	probably damaging	Het
Lepr	C	A	4: 101,764,934	N354K	probably benign	Het
Lypd3	G	T	7: 24,638,544	E112*	probably null	Het
Med13l	A	T	5: 118,748,684	N1550I	probably damaging	Het
Mettl2	C	T	11: 105,126,844	P60L	probably benign	Het
Muc4	A	G	16: 32,769,827	E850G	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nek1	A	G	8: 61,089,592	R739G	probably damaging	Het
Nipbl	A	T	15: 8,351,555	D584E	probably benign	Het
Nkain3	C	T	4: 20,158,388	V162M	possibly damaging	Het
Nmrk1	T	C	19: 18,641,480		probably benign	Het
Nsd2	T	C	5: 33,861,028		probably benign	Het
Olfr1198	A	T	2: 88,746,008	N293K	probably benign	Het
Olfr1270	T	A	2: 90,149,283	H241L	probably damaging	Het
Olfr133	T	C	17: 38,148,624	F12S	probably damaging	Het
Olfr1449	T	A	19: 12,935,605	V289D	probably damaging	Het
Olfr907	T	A	9: 38,499,122	M151K	possibly damaging	Het
Phex	T	A	X: 157,372,561		probably benign	Het
Pip5k1b	G	T	19: 24,378,892	D227E	probably damaging	Het
Prdm13	A	G	4: 21,683,914	I119T	unknown	Het
Rab19	G	T	6: 39,383,959	V14L	probably benign	Het
Rasa3	A	G	8: 13,580,118		probably benign	Het
Rgsl1	C	T	1: 153,802,328	S118N	probably damaging	Het
Rif1	C	T	2: 52,110,353	T1273M	possibly damaging	Het
Scn8a	A	G	15: 100,972,830	N254S	probably damaging	Het
Sema6a	T	C	18: 47,291,981	T188A	probably damaging	Het
Smarca2	A	T	19: 26,698,403	K1014N	probably damaging	Het
Smarca4	T	G	9: 21,700,139		probably null	Het
Sntb1	T	C	15: 55,676,356	R361G	probably benign	Het
Soga1	G	T	2: 157,060,262	R278S	probably damaging	Het
Stx5a	T	A	19: 8,754,911	I208N	probably damaging	Het
Tas2r102	T	A	6: 132,762,452	W108R	probably damaging	Het
Tcl1	A	G	12: 105,218,670	Y94H	probably damaging	Het
Tenm3	T	A	8: 48,236,594	Y1986F	probably damaging	Het
Tet2	G	A	3: 133,468,184	P1439L	probably benign	Het
Tiam2	T	C	17: 3,512,833		probably benign	Het
Ubap2l	G	A	3: 90,021,246	T526M	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,489	V503A	possibly damaging	Het
Ushbp1	T	A	8: 71,388,747		probably benign	Het
Usp28	C	T	9: 49,003,869	R115C	probably damaging	Het
Vldlr	A	T	19: 27,238,386	D261V	probably damaging	Het
Vmn2r5	C	T	3: 64,503,765	D461N	probably benign	Het
Vmn2r86	A	T	10: 130,446,396	F784I	probably damaging	Het
Zfp59	A	T	7: 27,854,088	I322F	probably damaging	Het
Zfp607a	A	T	7: 27,879,149	H548L	probably benign	Het
Zfp626	G	A	7: 27,818,623	C343Y	probably damaging	Het

Other mutations in Sh3pxd2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Sh3pxd2a	APN	19	47314155	missense	probably benign	0.20
IGL01606:Sh3pxd2a	APN	19	47268596	missense	probably benign
IGL02001:Sh3pxd2a	APN	19	47273447	missense	probably damaging	0.99
IGL02060:Sh3pxd2a	APN	19	47373378	splice site	probably benign
IGL02830:Sh3pxd2a	APN	19	47283078	missense	probably damaging	1.00
IGL03240:Sh3pxd2a	APN	19	47268026	missense	probably damaging	1.00
IGL03263:Sh3pxd2a	APN	19	47314043	missense	probably damaging	1.00
IGL03290:Sh3pxd2a	APN	19	47424516	missense	probably damaging	1.00
R0045:Sh3pxd2a	UTSW	19	47267183	missense	probably damaging	1.00
R0045:Sh3pxd2a	UTSW	19	47267183	missense	probably damaging	1.00
R0504:Sh3pxd2a	UTSW	19	47267747	missense	probably damaging	1.00
R0683:Sh3pxd2a	UTSW	19	47267511	missense	probably benign	0.04
R0883:Sh3pxd2a	UTSW	19	47268207	missense	probably damaging	1.00
R1276:Sh3pxd2a	UTSW	19	47268383	missense	probably benign
R1349:Sh3pxd2a	UTSW	19	47267721	missense	probably damaging	1.00
R1372:Sh3pxd2a	UTSW	19	47267721	missense	probably damaging	1.00
R1525:Sh3pxd2a	UTSW	19	47278425	missense	probably damaging	1.00
R1661:Sh3pxd2a	UTSW	19	47278320	missense	probably damaging	1.00
R1664:Sh3pxd2a	UTSW	19	47268382	missense	probably benign	0.02
R1766:Sh3pxd2a	UTSW	19	47273250	missense	probably benign	0.01
R1931:Sh3pxd2a	UTSW	19	47267508	missense	probably benign	0.00
R1932:Sh3pxd2a	UTSW	19	47267508	missense	probably benign	0.00
R2024:Sh3pxd2a	UTSW	19	47267264	missense	probably benign	0.35
R2165:Sh3pxd2a	UTSW	19	47278355	missense	probably damaging	1.00
R2210:Sh3pxd2a	UTSW	19	47267343	missense	possibly damaging	0.93
R2567:Sh3pxd2a	UTSW	19	47424569	missense	possibly damaging	0.94
R4097:Sh3pxd2a	UTSW	19	47424512	missense	probably damaging	1.00
R4466:Sh3pxd2a	UTSW	19	47364707	missense	possibly damaging	0.61
R4788:Sh3pxd2a	UTSW	19	47314079	missense	probably damaging	1.00
R4885:Sh3pxd2a	UTSW	19	47268693	missense	probably damaging	1.00
R4939:Sh3pxd2a	UTSW	19	47278404	missense	probably damaging	1.00
R5184:Sh3pxd2a	UTSW	19	47273411	missense	possibly damaging	0.90
R5340:Sh3pxd2a	UTSW	19	47268231	missense	probably benign	0.36
R5673:Sh3pxd2a	UTSW	19	47268666	missense	probably damaging	1.00
R5925:Sh3pxd2a	UTSW	19	47267612	missense	probably damaging	1.00
R5988:Sh3pxd2a	UTSW	19	47364638	missense	probably benign	0.16
R6120:Sh3pxd2a	UTSW	19	47267409	missense	probably damaging	0.99
R6432:Sh3pxd2a	UTSW	19	47269927	missense	probably damaging	0.99
R6650:Sh3pxd2a	UTSW	19	47268224	missense	probably benign	0.00
R6700:Sh3pxd2a	UTSW	19	47364707	missense	possibly damaging	0.61
R6831:Sh3pxd2a	UTSW	19	47283093	missense	probably damaging	1.00
R7015:Sh3pxd2a	UTSW	19	47268123	missense	probably benign	0.00
R7225:Sh3pxd2a	UTSW	19	47267389	missense	probably damaging	1.00
R7449:Sh3pxd2a	UTSW	19	47267652	missense	probably benign
R7695:Sh3pxd2a	UTSW	19	47267831	missense	probably damaging	1.00
R7904:Sh3pxd2a	UTSW	19	47320314	missense	possibly damaging	0.54
R8143:Sh3pxd2a	UTSW	19	47268699	missense	probably damaging	1.00
R8268:Sh3pxd2a	UTSW	19	47267594	missense	probably benign
R8290:Sh3pxd2a	UTSW	19	47314136	missense	probably damaging	1.00
R8350:Sh3pxd2a	UTSW	19	47268707	missense	probably damaging	1.00
R8350:Sh3pxd2a	UTSW	19	47269838	missense	probably null	0.72
R8742:Sh3pxd2a	UTSW	19	47286634	missense	probably benign	0.01
R8767:Sh3pxd2a	UTSW	19	47268906	missense	probably damaging	1.00
R8948:Sh3pxd2a	UTSW	19	47373443	missense	probably damaging	1.00
R9357:Sh3pxd2a	UTSW	19	47272009	missense	probably damaging	1.00
R9433:Sh3pxd2a	UTSW	19	47267100	missense	probably damaging	0.98
R9515:Sh3pxd2a	UTSW	19	47267171	missense	probably damaging	1.00
R9748:Sh3pxd2a	UTSW	19	47268654	missense	probably benign
V3553:Sh3pxd2a	UTSW	19	47267219	missense	probably benign	0.12
X0013:Sh3pxd2a	UTSW	19	47267864	missense	probably benign	0.01
X0026:Sh3pxd2a	UTSW	19	47464150	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCACCCACCTTGAAATGGGC -3'
(R):5'- AGGGTATCATAGGGACCCTGACAAC -3'

Sequencing Primer
(F):5'- AGGCAGGCGAGATCCTTC -3'
(R):5'- TGCAACTCACTGGCCTG -3'

Posted On

2013-07-30