Incidental Mutation 'R8274:Myo9b'
ID637897
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Namemyosin IXb
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R8274 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location71272714-71360713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71359836 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 2084 (A2084T)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
Predicted Effect probably benign
Transcript: ENSMUST00000071935
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168839
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170242
AA Change: A2084T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: A2084T

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212412
Predicted Effect probably benign
Transcript: ENSMUST00000212935
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,964 T42A possibly damaging Het
Adamts6 T C 13: 104,313,673 V294A probably benign Het
Ahr A C 12: 35,510,069 V195G probably benign Het
Ankrd17 A T 5: 90,282,859 I1022N probably benign Het
Arsk A T 13: 76,072,184 C264S probably damaging Het
Astn2 A G 4: 65,651,861 probably null Het
Atf7ip C A 6: 136,560,990 T407K probably benign Het
Axl A G 7: 25,764,013 I613T probably damaging Het
Baz2a T C 10: 128,121,847 M1021T probably benign Het
Cacna2d2 T C 9: 107,524,662 V765A possibly damaging Het
Chd7 T C 4: 8,839,432 Y1323H probably damaging Het
Col7a1 G T 9: 108,969,961 G1794V probably damaging Het
Csmd1 T C 8: 15,910,453 M3321V possibly damaging Het
Dcp1b T C 6: 119,183,651 S65P probably damaging Het
Depdc7 A G 2: 104,728,206 S157P probably benign Het
Dnah1 T A 14: 31,295,574 H1500L probably benign Het
Erbb2 C T 11: 98,433,896 A772V probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,377,490 K246* probably null Het
Gbp4 T C 5: 105,119,472 N527S probably benign Het
Gpr157 C T 4: 150,088,043 T97M probably damaging Het
Gpt2 T C 8: 85,516,224 L295P probably benign Het
Grm8 T A 6: 27,761,336 K296N probably benign Het
Gss T A 2: 155,587,504 I23L probably benign Het
Hk3 A G 13: 55,011,417 V442A possibly damaging Het
Hoxa3 C A 6: 52,170,544 R243L unknown Het
Junb T A 8: 84,978,429 M1L possibly damaging Het
Kcnh6 T C 11: 106,020,161 I514T probably damaging Het
Kif11 C A 19: 37,403,546 T463N probably damaging Het
Lmf2 C T 15: 89,352,663 G459S probably damaging Het
Lpl A G 8: 68,892,598 T85A possibly damaging Het
Lrrc29 T A 8: 105,315,534 I221F probably benign Het
Olfr830 T A 9: 18,875,499 H57Q probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ptprk G T 10: 28,580,412 R1056L probably damaging Het
Rfx2 C T 17: 56,804,348 A75T probably benign Het
Scn11a T C 9: 119,803,482 T441A probably benign Het
Siglec1 A G 2: 131,083,910 V292A probably benign Het
Smok2a G A 17: 13,226,894 A453T probably benign Het
Tmcc3 T C 10: 94,586,876 V427A probably damaging Het
Tmem208 T G 8: 105,328,625 I106S probably damaging Het
Trav9-2 G T 14: 53,591,353 R60L probably benign Het
Vcan T C 13: 89,704,970 K624E probably benign Het
Zfp318 A T 17: 46,412,989 M1973L probably benign Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71348735 missense probably benign
IGL01020:Myo9b APN 8 71352000 missense probably benign
IGL01479:Myo9b APN 8 71359342 missense probably damaging 1.00
IGL01704:Myo9b APN 8 71359642 missense probably damaging 0.98
IGL01761:Myo9b APN 8 71349152 missense probably damaging 0.96
IGL01766:Myo9b APN 8 71290517 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71356318 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71355257 missense possibly damaging 0.93
IGL01838:Myo9b APN 8 71334390 missense probably damaging 0.99
IGL02318:Myo9b APN 8 71354124 missense probably damaging 0.98
IGL02333:Myo9b APN 8 71358993 missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71291045 missense probably damaging 1.00
IGL02514:Myo9b APN 8 71291006 missense probably damaging 1.00
IGL02593:Myo9b APN 8 71290773 missense probably damaging 1.00
IGL03075:Myo9b APN 8 71354527 missense probably damaging 1.00
IGL03332:Myo9b APN 8 71348774 missense possibly damaging 0.78
avantgarde UTSW 8 71344162 missense probably damaging 1.00
Freaky UTSW 8 71290819 missense probably damaging 1.00
iconoclastic UTSW 8 71290475 missense probably benign 0.37
unconventional UTSW 8 71348597 missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71322947 missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71342812 missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71333768 missense probably damaging 1.00
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0144:Myo9b UTSW 8 71346043 missense probably damaging 1.00
R0207:Myo9b UTSW 8 71355225 splice site probably benign
R0226:Myo9b UTSW 8 71353832 missense probably damaging 1.00
R0227:Myo9b UTSW 8 71344162 missense probably damaging 1.00
R0244:Myo9b UTSW 8 71321813 missense probably damaging 1.00
R0277:Myo9b UTSW 8 71355952 splice site probably benign
R0362:Myo9b UTSW 8 71347770 missense probably damaging 1.00
R0689:Myo9b UTSW 8 71330756 missense probably damaging 1.00
R0844:Myo9b UTSW 8 71290475 missense probably benign 0.37
R1051:Myo9b UTSW 8 71355822 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1526:Myo9b UTSW 8 71355764 missense probably damaging 1.00
R1544:Myo9b UTSW 8 71290976 missense probably damaging 1.00
R1565:Myo9b UTSW 8 71315192 missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71322978 missense probably damaging 1.00
R1745:Myo9b UTSW 8 71354047 missense probably damaging 1.00
R1820:Myo9b UTSW 8 71333358 missense probably damaging 1.00
R2037:Myo9b UTSW 8 71290866 missense probably damaging 1.00
R2050:Myo9b UTSW 8 71290550 missense probably damaging 1.00
R2056:Myo9b UTSW 8 71359690 missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71333699 missense probably damaging 1.00
R2423:Myo9b UTSW 8 71327940 missense probably damaging 1.00
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2873:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2874:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2920:Myo9b UTSW 8 71325857 missense probably damaging 0.98
R2926:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2939:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2940:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3033:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3040:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3689:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3691:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3735:Myo9b UTSW 8 71348597 missense probably benign 0.00
R4194:Myo9b UTSW 8 71359624 missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71355765 missense probably damaging 1.00
R4457:Myo9b UTSW 8 71290999 missense probably damaging 1.00
R4478:Myo9b UTSW 8 71291081 missense probably damaging 1.00
R4496:Myo9b UTSW 8 71334337 missense probably benign 0.01
R4544:Myo9b UTSW 8 71327941 missense probably damaging 1.00
R4580:Myo9b UTSW 8 71315135 missense probably damaging 1.00
R4736:Myo9b UTSW 8 71356592 missense probably damaging 1.00
R5068:Myo9b UTSW 8 71349055 missense probably damaging 1.00
R5124:Myo9b UTSW 8 71355839 missense probably damaging 1.00
R5194:Myo9b UTSW 8 71349089 missense probably benign 0.01
R5296:Myo9b UTSW 8 71333388 missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71323274 missense probably benign 0.06
R5664:Myo9b UTSW 8 71359882 missense probably benign 0.13
R5677:Myo9b UTSW 8 71343686 missense probably damaging 1.00
R5680:Myo9b UTSW 8 71290372 missense probably benign 0.00
R5982:Myo9b UTSW 8 71348396 missense probably benign 0.05
R6344:Myo9b UTSW 8 71327914 missense probably damaging 1.00
R6352:Myo9b UTSW 8 71348410 missense probably benign 0.16
R6352:Myo9b UTSW 8 71348411 missense probably benign
R6411:Myo9b UTSW 8 71322955 nonsense probably null
R6425:Myo9b UTSW 8 71333628 missense probably damaging 1.00
R6505:Myo9b UTSW 8 71355857 missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71352159 splice site probably null
R6811:Myo9b UTSW 8 71356578 missense probably damaging 1.00
R6813:Myo9b UTSW 8 71323305 missense probably damaging 1.00
R6954:Myo9b UTSW 8 71290819 missense probably damaging 1.00
R7124:Myo9b UTSW 8 71333701 nonsense probably null
R7255:Myo9b UTSW 8 71290891 missense probably damaging 1.00
R7293:Myo9b UTSW 8 71325905 missense probably benign 0.00
R7342:Myo9b UTSW 8 71355774 missense probably damaging 1.00
R7451:Myo9b UTSW 8 71352188 missense probably benign 0.28
R7482:Myo9b UTSW 8 71342798 missense probably benign 0.00
R7508:Myo9b UTSW 8 71354801 missense probably benign 0.00
R7957:Myo9b UTSW 8 71354761 missense probably benign 0.12
R8062:Myo9b UTSW 8 71321813 missense probably damaging 0.99
R8108:Myo9b UTSW 8 71348342 missense probably damaging 0.99
R8197:Myo9b UTSW 8 71290963 missense probably damaging 1.00
X0066:Myo9b UTSW 8 71323898 missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71290709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGGTCAGAGTGAAGACACC -3'
(R):5'- TTCTCAGAAAGTGAAGGCCAG -3'

Sequencing Primer
(F):5'- TGAAGACACCTCGGAGGACC -3'
(R):5'- ACAGCTGGGATGCCAGTTC -3'
Posted On2020-07-28