Incidental Mutation 'R8274:Adamts6'
ID637918
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonymsb2b2187.1Clo, b2b2182Clo, ADAM-TS6, b2b2029Clo, b2b1879.1Clo, b2b2228Clo, A930019D11Rik
Accession Numbers

NCBI RefSeq: NM_001081020.1; MGI: 1347348

Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R8274 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location104287835-104496695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104313673 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 294 (V294A)
Ref Sequence ENSEMBL: ENSMUSP00000064570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766]
Predicted Effect probably benign
Transcript: ENSMUST00000065766
AA Change: V294A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: V294A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,964 T42A possibly damaging Het
Ahr A C 12: 35,510,069 V195G probably benign Het
Ankrd17 A T 5: 90,282,859 I1022N probably benign Het
Arsk A T 13: 76,072,184 C264S probably damaging Het
Astn2 A G 4: 65,651,861 probably null Het
Atf7ip C A 6: 136,560,990 T407K probably benign Het
Axl A G 7: 25,764,013 I613T probably damaging Het
Baz2a T C 10: 128,121,847 M1021T probably benign Het
Cacna2d2 T C 9: 107,524,662 V765A possibly damaging Het
Chd7 T C 4: 8,839,432 Y1323H probably damaging Het
Col7a1 G T 9: 108,969,961 G1794V probably damaging Het
Csmd1 T C 8: 15,910,453 M3321V possibly damaging Het
Dcp1b T C 6: 119,183,651 S65P probably damaging Het
Depdc7 A G 2: 104,728,206 S157P probably benign Het
Dnah1 T A 14: 31,295,574 H1500L probably benign Het
Erbb2 C T 11: 98,433,896 A772V probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,377,490 K246* probably null Het
Gbp4 T C 5: 105,119,472 N527S probably benign Het
Gpr157 C T 4: 150,088,043 T97M probably damaging Het
Gpt2 T C 8: 85,516,224 L295P probably benign Het
Grm8 T A 6: 27,761,336 K296N probably benign Het
Gss T A 2: 155,587,504 I23L probably benign Het
Hk3 A G 13: 55,011,417 V442A possibly damaging Het
Hoxa3 C A 6: 52,170,544 R243L unknown Het
Junb T A 8: 84,978,429 M1L possibly damaging Het
Kcnh6 T C 11: 106,020,161 I514T probably damaging Het
Kif11 C A 19: 37,403,546 T463N probably damaging Het
Lmf2 C T 15: 89,352,663 G459S probably damaging Het
Lpl A G 8: 68,892,598 T85A possibly damaging Het
Lrrc29 T A 8: 105,315,534 I221F probably benign Het
Myo9b G A 8: 71,359,836 A2084T probably benign Het
Olfr830 T A 9: 18,875,499 H57Q probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ptprk G T 10: 28,580,412 R1056L probably damaging Het
Rfx2 C T 17: 56,804,348 A75T probably benign Het
Scn11a T C 9: 119,803,482 T441A probably benign Het
Siglec1 A G 2: 131,083,910 V292A probably benign Het
Smok2a G A 17: 13,226,894 A453T probably benign Het
Tmcc3 T C 10: 94,586,876 V427A probably damaging Het
Tmem208 T G 8: 105,328,625 I106S probably damaging Het
Trav9-2 G T 14: 53,591,353 R60L probably benign Het
Vcan T C 13: 89,704,970 K624E probably benign Het
Zfp318 A T 17: 46,412,989 M1973L probably benign Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104429790 missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104297218 nonsense probably null
IGL01305:Adamts6 APN 13 104390082 missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104297164 missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104390192 splice site probably benign
IGL01678:Adamts6 APN 13 104313688 missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104390135 missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104313660 missense probably null 1.00
IGL02217:Adamts6 APN 13 104462365 splice site probably benign
IGL02828:Adamts6 APN 13 104297470 missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104297275 missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104444956 utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104444215 missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104314334 missense possibly damaging 0.77
De_vito UTSW 13 104347392 critical splice donor site probably null
ANU22:Adamts6 UTSW 13 104390082 missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104297491 missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104390076 critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104426930 splice site probably benign
R0549:Adamts6 UTSW 13 104297255 missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104444927 missense probably benign 0.00
R0703:Adamts6 UTSW 13 104352847 missense probably damaging 1.00
R0799:Adamts6 UTSW 13 104314271 missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104413789 missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104312881 missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104493637 missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104444875 missense probably benign 0.26
R1619:Adamts6 UTSW 13 104312777 missense probably benign 0.14
R1727:Adamts6 UTSW 13 104428964 splice site probably benign
R1967:Adamts6 UTSW 13 104426951 nonsense probably null
R2013:Adamts6 UTSW 13 104314304 missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104462238 missense probably benign 0.00
R2432:Adamts6 UTSW 13 104426977 missense probably benign 0.01
R3118:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104312904 missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4795:Adamts6 UTSW 13 104444128 nonsense probably null
R4841:Adamts6 UTSW 13 104312787 missense probably benign 0.00
R4976:Adamts6 UTSW 13 104297490 missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104307243 missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104493622 missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104352815 missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104347350 missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104479535 missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104297425 missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104347392 critical splice donor site probably null
R6243:Adamts6 UTSW 13 104314301 missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104462282 missense probably benign
R6743:Adamts6 UTSW 13 104428928 missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104313652 missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104312759 missense probably benign
R7351:Adamts6 UTSW 13 104390112 missense possibly damaging 0.63
R7520:Adamts6 UTSW 13 104297186 missense probably benign 0.01
R7866:Adamts6 UTSW 13 104413749 nonsense probably null
R8348:Adamts6 UTSW 13 104479519 missense probably damaging 0.99
R8448:Adamts6 UTSW 13 104479519 missense probably damaging 0.99
X0065:Adamts6 UTSW 13 104493628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTCTTGAAATGGTACTGGG -3'
(R):5'- TCGTCAGGTAAGTCGTACAAATC -3'

Sequencing Primer
(F):5'- GGTACTGGGTAAAATAATATGTT -3'
(R):5'- GTCAGGTAAGTCGTACAAATCAAATG -3'
Posted On2020-07-28