Incidental Mutation 'R8275:Akap2'
ID637931
Institutional Source Beutler Lab
Gene Symbol Akap2
Ensembl Gene ENSMUSG00000038729
Gene NameA kinase (PRKA) anchor protein 2
SynonymsAKAP-KL, B230340M18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001035533; MGI: 1306795

Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location57717657-57896984 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 57886329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043456] [ENSMUST00000098064] [ENSMUST00000098066] [ENSMUST00000102902] [ENSMUST00000102903] [ENSMUST00000107598] [ENSMUST00000107600]
Predicted Effect probably null
Transcript: ENSMUST00000043456
SMART Domains Protein: ENSMUSP00000048678
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 568 885 2.5e-17 PFAM
Pfam:RII_binding_1 585 602 1.6e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098064
SMART Domains Protein: ENSMUSP00000095672
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102902
SMART Domains Protein: ENSMUSP00000099966
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102903
SMART Domains Protein: ENSMUSP00000099967
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107598
SMART Domains Protein: ENSMUSP00000103224
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107600
SMART Domains Protein: ENSMUSP00000103226
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 193 204 N/A INTRINSIC
low complexity region 254 268 N/A INTRINSIC
coiled coil region 297 355 N/A INTRINSIC
Pfam:AKAP2_C 636 913 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150412
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the regulatory subunit of protein kinase A and is found associated with the actin cytoskeleton. The encoded protein mediates signals carried by cAMP and may be involved in creating polarity in certain signaling processes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Akap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
A9681:Akap2 UTSW 4 57855358 missense probably damaging 1.00
IGL02835:Akap2 UTSW 4 57883044 missense probably damaging 1.00
R0284:Akap2 UTSW 4 57855207 missense probably damaging 1.00
R0356:Akap2 UTSW 4 57855628 missense possibly damaging 0.48
R0594:Akap2 UTSW 4 57856752 missense probably benign 0.00
R0614:Akap2 UTSW 4 57856720 missense probably benign 0.41
R0617:Akap2 UTSW 4 57829434 intron probably benign
R1228:Akap2 UTSW 4 57856909 missense probably damaging 1.00
R2081:Akap2 UTSW 4 57855927 missense possibly damaging 0.49
R2128:Akap2 UTSW 4 57854890 missense probably benign 0.40
R4667:Akap2 UTSW 4 57855655 missense possibly damaging 0.80
R4804:Akap2 UTSW 4 57854688 missense probably benign 0.05
R4989:Akap2 UTSW 4 57856552 missense probably benign
R5135:Akap2 UTSW 4 57855912 missense probably benign 0.00
R5292:Akap2 UTSW 4 57855356 missense probably damaging 0.98
R5420:Akap2 UTSW 4 57856062 missense probably benign 0.08
R5420:Akap2 UTSW 4 57856434 missense probably damaging 1.00
R5517:Akap2 UTSW 4 57855987 missense probably damaging 0.99
R5648:Akap2 UTSW 4 57854848 missense probably damaging 1.00
R5886:Akap2 UTSW 4 57856295 missense probably damaging 1.00
R5993:Akap2 UTSW 4 57855273 missense possibly damaging 0.86
R6133:Akap2 UTSW 4 57855516 nonsense probably null
R6189:Akap2 UTSW 4 57855928 missense probably benign 0.00
R6221:Akap2 UTSW 4 57855618 nonsense probably null
R6532:Akap2 UTSW 4 57855174 missense probably benign 0.00
R6760:Akap2 UTSW 4 57856026 missense probably damaging 1.00
R6792:Akap2 UTSW 4 57855880 missense possibly damaging 0.90
R7128:Akap2 UTSW 4 57855816 missense probably benign 0.03
R7269:Akap2 UTSW 4 57855217 missense probably damaging 1.00
R7837:Akap2 UTSW 4 57855262 missense probably damaging 1.00
R7940:Akap2 UTSW 4 57883026 missense probably damaging 0.98
R8094:Akap2 UTSW 4 57886319 missense possibly damaging 0.81
Z1177:Akap2 UTSW 4 57856348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGGTTGTATAATGATCCTCCC -3'
(R):5'- GACCAAGGTCTTCTCCAACC -3'

Sequencing Primer
(F):5'- GGTTGTATAATGATCCTCCCCCTCC -3'
(R):5'- AGCACAGCGGTGTTCATTATC -3'
Posted On2020-07-28