Incidental Mutation 'R8275:Zfp804b'
ID637932
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6772289 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 258 (R258Q)
Ref Sequence ENSEMBL: ENSMUSP00000143568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably benign
Transcript: ENSMUST00000164784
AA Change: R222Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: R222Q

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200317
AA Change: R258Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: R258Q

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
R7574:Zfp804b UTSW 5 6772301 missense possibly damaging 0.74
R7609:Zfp804b UTSW 5 6770066 missense possibly damaging 0.90
R7654:Zfp804b UTSW 5 6769458 missense probably damaging 0.97
R7669:Zfp804b UTSW 5 6769362 missense probably damaging 1.00
R7717:Zfp804b UTSW 5 6771293 missense possibly damaging 0.50
R7721:Zfp804b UTSW 5 6771263 missense possibly damaging 0.55
R7830:Zfp804b UTSW 5 6771124 missense probably benign
R7937:Zfp804b UTSW 5 6771866 missense possibly damaging 0.49
R7941:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R8093:Zfp804b UTSW 5 6770082 missense probably benign 0.02
R8714:Zfp804b UTSW 5 6772378 nonsense probably null
R8788:Zfp804b UTSW 5 6772635 missense probably benign 0.00
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGAGAAAGCCATGTGAGTGC -3'
(R):5'- CTACAATCAGATAGGCGGCAC -3'

Sequencing Primer
(F):5'- ATGTGAGTGCCCGCTGC -3'
(R):5'- CAATCAGATAGGCGGCACTTGTTTG -3'
Posted On2020-07-28