Incidental Mutation 'R8275:Vps33a'
ID 637934
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene Name VPS33A CORVET/HOPS core subunit
Synonyms 3830421M04Rik, bf
MMRRC Submission 067698-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8275 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123666820-123711104 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123707522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 148 (D148E)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
AlphaFold Q9D2N9
Predicted Effect probably damaging
Transcript: ENSMUST00000031388
AA Change: D148E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: D148E

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197467
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alx1 T C 10: 102,864,250 (GRCm39) D73G probably benign Het
Asah1 G A 8: 41,801,159 (GRCm39) H156Y probably damaging Het
Cgn G A 3: 94,682,263 (GRCm39) L439F possibly damaging Het
Creb1 C A 1: 64,597,687 (GRCm39) T7K probably benign Het
Cyp2c54 T A 19: 40,026,749 (GRCm39) I469L probably benign Het
Cyp2s1 T A 7: 25,508,735 (GRCm39) T236S probably benign Het
Duox1 T C 2: 122,175,249 (GRCm39) I1349T probably benign Het
Efhd2 C T 4: 141,602,073 (GRCm39) A36T probably benign Het
Espl1 G A 15: 102,211,188 (GRCm39) probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat3 T A 9: 16,158,046 (GRCm39) Q1188L probably damaging Het
Flt1 A T 5: 147,614,957 (GRCm39) Y330N probably damaging Het
Golga4 A T 9: 118,361,627 (GRCm39) S202C probably damaging Het
Htr2b C T 1: 86,030,294 (GRCm39) D134N probably damaging Het
Katna1 T A 10: 7,628,574 (GRCm39) C268S probably damaging Het
Lama4 T C 10: 38,948,807 (GRCm39) Y857H probably damaging Het
Lyst T C 13: 13,950,667 (GRCm39) I3741T probably benign Het
Mcm4 T C 16: 15,452,435 (GRCm39) I233V probably damaging Het
Mettl22 T C 16: 8,303,792 (GRCm39) V286A possibly damaging Het
Nav3 C A 10: 109,527,984 (GRCm39) G1503V noncoding transcript Het
Obox1 T A 7: 15,290,153 (GRCm39) N165K probably damaging Het
Or11g2 T A 14: 50,855,868 (GRCm39) M63K probably damaging Het
Oxa1l T A 14: 54,600,758 (GRCm39) I77N possibly damaging Het
Pakap T C 4: 57,886,329 (GRCm39) probably null Het
Papss2 T C 19: 32,615,760 (GRCm39) L164P probably damaging Het
Pikfyve T A 1: 65,292,501 (GRCm39) probably benign Het
Polr2a G A 11: 69,638,882 (GRCm39) R51C probably damaging Het
Rsph10b C G 5: 143,903,323 (GRCm39) T606S possibly damaging Het
Siglecg T C 7: 43,061,892 (GRCm39) V546A probably benign Het
Slc22a29 T C 19: 8,146,681 (GRCm39) S374G probably benign Het
Tia1 C T 6: 86,404,718 (GRCm39) Q318* probably null Het
Trpm2 T A 10: 77,801,859 (GRCm39) K69* probably null Het
Unc80 C T 1: 66,679,773 (GRCm39) R2115* probably null Het
Usp35 A G 7: 96,964,026 (GRCm39) S436P probably damaging Het
Vmn1r220 A T 13: 23,368,483 (GRCm39) L71* probably null Het
Vmn2r15 A T 5: 109,434,150 (GRCm39) D851E probably benign Het
Zfp729a G A 13: 67,768,223 (GRCm39) H669Y probably benign Het
Zfp804b C T 5: 6,822,289 (GRCm39) R258Q probably benign Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123,711,006 (GRCm39) missense probably benign 0.00
IGL01459:Vps33a APN 5 123,673,371 (GRCm39) missense probably benign 0.08
IGL02473:Vps33a APN 5 123,707,634 (GRCm39) missense probably damaging 1.00
IGL02899:Vps33a APN 5 123,669,239 (GRCm39) missense probably damaging 1.00
R0498:Vps33a UTSW 5 123,709,024 (GRCm39) missense probably benign 0.40
R1134:Vps33a UTSW 5 123,708,975 (GRCm39) missense probably damaging 0.97
R1928:Vps33a UTSW 5 123,696,684 (GRCm39) missense probably benign 0.02
R2012:Vps33a UTSW 5 123,669,244 (GRCm39) splice site probably null
R2926:Vps33a UTSW 5 123,707,634 (GRCm39) missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123,673,274 (GRCm39) splice site probably null
R3872:Vps33a UTSW 5 123,669,255 (GRCm39) missense probably benign 0.16
R4437:Vps33a UTSW 5 123,669,947 (GRCm39) missense probably benign
R5153:Vps33a UTSW 5 123,696,691 (GRCm39) missense probably damaging 1.00
R5396:Vps33a UTSW 5 123,696,693 (GRCm39) missense probably damaging 0.98
R5686:Vps33a UTSW 5 123,685,064 (GRCm39) critical splice donor site probably null
R5714:Vps33a UTSW 5 123,707,563 (GRCm39) missense probably benign
R5814:Vps33a UTSW 5 123,703,119 (GRCm39) missense probably damaging 1.00
R6845:Vps33a UTSW 5 123,673,335 (GRCm39) missense probably benign 0.02
R7183:Vps33a UTSW 5 123,673,278 (GRCm39) missense probably null 0.83
R7359:Vps33a UTSW 5 123,696,696 (GRCm39) missense probably benign 0.00
R7593:Vps33a UTSW 5 123,674,619 (GRCm39) missense probably benign 0.00
R7855:Vps33a UTSW 5 123,709,042 (GRCm39) missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123,673,312 (GRCm39) missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123,696,738 (GRCm39) missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123,672,015 (GRCm39) missense probably benign 0.04
R8434:Vps33a UTSW 5 123,671,944 (GRCm39) missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123,709,538 (GRCm39) critical splice donor site probably null
R8879:Vps33a UTSW 5 123,671,962 (GRCm39) missense probably damaging 1.00
R8880:Vps33a UTSW 5 123,707,506 (GRCm39) missense probably damaging 0.98
R9172:Vps33a UTSW 5 123,674,604 (GRCm39) missense probably benign 0.17
R9440:Vps33a UTSW 5 123,703,047 (GRCm39) missense probably damaging 1.00
R9502:Vps33a UTSW 5 123,696,705 (GRCm39) missense probably benign 0.00
R9725:Vps33a UTSW 5 123,669,135 (GRCm39) missense possibly damaging 0.95
X0026:Vps33a UTSW 5 123,685,160 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATTGGAAGCAGCAGTGTGAC -3'
(R):5'- ACCTCTGATTCTAAGCAGCAC -3'

Sequencing Primer
(F):5'- TGTGACACACCCAGCAGTG -3'
(R):5'- TCTGATTCTAAGCAGCACATAAGC -3'
Posted On 2020-07-28