Incidental Mutation 'R8275:Siglecg'
ID637940
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Namesialic acid binding Ig-like lectin G
SynonymsmSiglec-G, A630096C01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8275 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43408204-43418358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43412468 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 546 (V546A)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
Predicted Effect probably benign
Transcript: ENSMUST00000005592
AA Change: V546A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: V546A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43409057 missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43411795 missense probably benign 0.02
IGL01806:Siglecg APN 7 43411464 splice site probably null
IGL01947:Siglecg APN 7 43408763 missense probably benign 0.43
IGL02257:Siglecg APN 7 43411904 missense probably benign 0.00
IGL02410:Siglecg APN 7 43408829 missense probably damaging 0.99
IGL02454:Siglecg APN 7 43408895 missense probably benign 0.00
Chamonix UTSW 7 43409422 missense possibly damaging 0.91
Montblanc UTSW 7 43411386 intron probably benign
Shenandoah UTSW 7 43408802 missense probably damaging 0.99
shenandoah2 UTSW 7 43412017 missense possibly damaging 0.82
Sherando UTSW 7 43409057 missense possibly damaging 0.64
Smokies UTSW 7 43409279 missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43418052 missense probably damaging 1.00
R0134:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0225:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0480:Siglecg UTSW 7 43411126 missense probably benign 0.42
R1538:Siglecg UTSW 7 43417889 missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43408941 missense probably benign 0.17
R2358:Siglecg UTSW 7 43409422 missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43417908 missense probably benign 0.03
R4754:Siglecg UTSW 7 43411871 intron probably benign
R5017:Siglecg UTSW 7 43411386 intron probably benign
R5713:Siglecg UTSW 7 43408802 missense probably damaging 0.99
R5777:Siglecg UTSW 7 43409413 missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43412204 intron probably benign
R6153:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43408754 missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43409057 missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43408979 missense probably benign 0.00
R7066:Siglecg UTSW 7 43411742 missense probably benign 0.40
R7884:Siglecg UTSW 7 43409279 missense probably benign 0.02
RF006:Siglecg UTSW 7 43408864 nonsense probably null
Z1177:Siglecg UTSW 7 43412022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTCGCTATGGAGGGGC -3'
(R):5'- TCTTCTGGAGGGTCTTCACG -3'

Sequencing Primer
(F):5'- CTCTGTGGTTAGAGCGAAGTC -3'
(R):5'- TCTTCACGCTGAGGGAATAATCG -3'
Posted On2020-07-28