Incidental Mutation 'R8275:Usp35'
ID637942
Institutional Source Beutler Lab
Gene Symbol Usp35
Ensembl Gene ENSMUSG00000035713
Gene Nameubiquitin specific peptidase 35
SynonymsLOC381901, LOC244144
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97309380-97332020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97314819 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 436 (S436P)
Ref Sequence ENSEMBL: ENSMUSP00000137726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139582] [ENSMUST00000168435]
Predicted Effect probably damaging
Transcript: ENSMUST00000139582
AA Change: S436P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137726
Gene: ENSMUSG00000035713
AA Change: S436P

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 5.2e-50 PFAM
Pfam:UCH_1 441 890 1.5e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168435
AA Change: S436P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137927
Gene: ENSMUSG00000035713
AA Change: S436P

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 7.1e-48 PFAM
Pfam:UCH_1 441 890 7.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Usp35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03239:Usp35 APN 7 97321592 missense possibly damaging 0.62
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0739:Usp35 UTSW 7 97311667 nonsense probably null
R2655:Usp35 UTSW 7 97312147 missense probably benign
R3623:Usp35 UTSW 7 97312620 missense probably damaging 1.00
R4750:Usp35 UTSW 7 97310339 missense possibly damaging 0.85
R4967:Usp35 UTSW 7 97313575 missense probably damaging 1.00
R5317:Usp35 UTSW 7 97311639 missense probably damaging 0.99
R5341:Usp35 UTSW 7 97325927 missense probably damaging 1.00
R5761:Usp35 UTSW 7 97312351 missense probably benign 0.00
R5894:Usp35 UTSW 7 97313077 missense probably damaging 1.00
R6113:Usp35 UTSW 7 97324326 missense probably damaging 1.00
R6282:Usp35 UTSW 7 97325948 missense probably damaging 1.00
R6454:Usp35 UTSW 7 97311560 missense probably damaging 0.98
R6454:Usp35 UTSW 7 97311644 nonsense probably null
R7142:Usp35 UTSW 7 97311547 missense probably damaging 0.97
R7158:Usp35 UTSW 7 97325964 start codon destroyed probably null 0.89
R7260:Usp35 UTSW 7 97320079 missense probably damaging 0.98
R8270:Usp35 UTSW 7 97312344 missense probably benign
R8795:Usp35 UTSW 7 97311960 missense possibly damaging 0.92
R8795:Usp35 UTSW 7 97312063 missense probably benign
RF003:Usp35 UTSW 7 97322096 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGATGCCAGCACTAGGTTC -3'
(R):5'- AGTGGGTTCTAGTCCAGGAG -3'

Sequencing Primer
(F):5'- GCACTAGGTTCAAAGCTTGC -3'
(R):5'- GGGCTTCCTGGAAGAAAGTG -3'
Posted On2020-07-28