Incidental Mutation 'R8275:Katna1'
ID637946
Institutional Source Beutler Lab
Gene Symbol Katna1
Ensembl Gene ENSMUSG00000019794
Gene Namekatanin p60 (ATPase-containing) subunit A1
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011835.2; MGI:1344353

Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location7726000-7763150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7752810 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 268 (C268S)
Ref Sequence ENSEMBL: ENSMUSP00000132514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019929] [ENSMUST00000165806] [ENSMUST00000173400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019929
AA Change: C266S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019929
Gene: ENSMUSG00000019794
AA Change: C266S

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 2e-44 PDB
AAA 241 383 5.2e-22 SMART
low complexity region 387 400 N/A INTRINSIC
Pfam:Vps4_C 438 489 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165806
AA Change: C268S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132514
Gene: ENSMUSG00000019794
AA Change: C268S

DomainStartEndE-ValueType
PDB:2RPA|A 1 74 6e-46 PDB
AAA 243 385 3.23e-20 SMART
low complexity region 389 402 N/A INTRINSIC
Pfam:Vps4_C 440 491 4.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173400
SMART Domains Protein: ENSMUSP00000133588
Gene: ENSMUSG00000019794

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-47 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. This gene encodes the p80 subunit. This protein is a member of the AAA family of ATPases. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2011]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(13)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Katna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Katna1 APN 10 7762804 missense probably damaging 1.00
IGL00332:Katna1 APN 10 7762994 utr 3 prime probably benign
IGL01385:Katna1 APN 10 7752810 missense probably damaging 1.00
IGL01592:Katna1 APN 10 7741454 missense probably damaging 1.00
P0018:Katna1 UTSW 10 7741459 missense probably damaging 1.00
R0310:Katna1 UTSW 10 7743749 intron probably benign
R2078:Katna1 UTSW 10 7743569 missense probably benign 0.00
R2975:Katna1 UTSW 10 7743709 missense probably benign 0.01
R3978:Katna1 UTSW 10 7752754 missense probably damaging 1.00
R3979:Katna1 UTSW 10 7752754 missense probably damaging 1.00
R4477:Katna1 UTSW 10 7738830 missense probably damaging 0.98
R4480:Katna1 UTSW 10 7738830 missense probably damaging 0.98
R5796:Katna1 UTSW 10 7760811 missense probably damaging 0.98
R7938:Katna1 UTSW 10 7761311 missense probably benign 0.00
R7965:Katna1 UTSW 10 7738859 missense probably benign
R8784:Katna1 UTSW 10 7738815 missense possibly damaging 0.68
R8842:Katna1 UTSW 10 7738836 missense probably benign
Z1176:Katna1 UTSW 10 7759785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGCCATGTCTGTGTTTATC -3'
(R):5'- CAGAAGCCAAAGTTACTCATGCTC -3'

Sequencing Primer
(F):5'- CTGTGTTTATCATCCTCAGAAAACC -3'
(R):5'- TCAGGTCCTATGAAGAGTGTCACC -3'
Posted On2020-07-28