Incidental Mutation 'R8275:Zfp729a'
ID637954
Institutional Source Beutler Lab
Gene Symbol Zfp729a
Ensembl Gene ENSMUSG00000021510
Gene Namezinc finger protein 729a
SynonymsA530054K11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67612763-67637791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67620104 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 669 (H669Y)
Ref Sequence ENSEMBL: ENSMUSP00000012314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012314]
Predicted Effect probably benign
Transcript: ENSMUST00000012314
AA Change: H669Y

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000012314
Gene: ENSMUSG00000021510
AA Change: H669Y

DomainStartEndE-ValueType
KRAB 15 75 6.23e-34 SMART
ZnF_C2H2 91 111 1.91e1 SMART
ZnF_C2H2 147 169 8.34e-3 SMART
PHD 148 209 9.1e0 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 4.47e-3 SMART
PHD 232 293 1.11e1 SMART
RING 233 292 9.27e0 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
PHD 316 377 1.35e1 SMART
ZnF_C2H2 343 365 2.57e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
Pfam:zf-C2HC_2 402 422 7.7e-4 PFAM
ZnF_C2H2 427 449 1.67e-2 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
PHD 456 517 5.33e0 SMART
RING 457 516 9.02e0 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
PHD 540 601 1.46e1 SMART
ZnF_C2H2 567 589 3.58e-2 SMART
ZnF_C2H2 595 617 8.34e-3 SMART
ZnF_C2H2 651 673 4.11e-2 SMART
PHD 652 713 4.64e0 SMART
RING 653 712 6.37e0 SMART
ZnF_C2H2 679 701 2.4e-3 SMART
ZnF_C2H2 707 729 1.03e-2 SMART
ZnF_C2H2 735 757 1.47e-3 SMART
PHD 736 797 5.44e0 SMART
RING 737 796 5.88e0 SMART
ZnF_C2H2 763 785 6.67e-2 SMART
ZnF_C2H2 791 813 2.36e-2 SMART
ZnF_C2H2 819 841 6.32e-3 SMART
ZnF_C2H2 847 869 1.26e-2 SMART
ZnF_C2H2 875 897 6.78e-3 SMART
PHD 876 937 4.55e0 SMART
ZnF_C2H2 903 925 9.58e-3 SMART
ZnF_C2H2 931 953 9.08e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Zfp729a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zfp729a APN 13 67619321 missense probably benign 0.01
IGL01956:Zfp729a APN 13 67621686 missense probably damaging 1.00
IGL02852:Zfp729a APN 13 67619951 missense possibly damaging 0.69
IGL03130:Zfp729a APN 13 67619642 splice site probably null
adalet UTSW 13 67619507 missense probably benign 0.00
R0329:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0330:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0383:Zfp729a UTSW 13 67621673 missense possibly damaging 0.83
R0545:Zfp729a UTSW 13 67620226 missense probably benign 0.09
R1013:Zfp729a UTSW 13 67619507 missense probably benign 0.00
R1079:Zfp729a UTSW 13 67619675 missense possibly damaging 0.71
R1255:Zfp729a UTSW 13 67621846 missense probably benign 0.03
R1525:Zfp729a UTSW 13 67619321 missense probably benign 0.01
R1768:Zfp729a UTSW 13 67619251 missense probably benign 0.00
R1926:Zfp729a UTSW 13 67619557 missense probably benign 0.29
R2043:Zfp729a UTSW 13 67621172 missense probably damaging 1.00
R2118:Zfp729a UTSW 13 67621494 splice site probably null
R3820:Zfp729a UTSW 13 67621319 missense probably damaging 1.00
R3830:Zfp729a UTSW 13 67619878 missense probably damaging 1.00
R3926:Zfp729a UTSW 13 67620191 nonsense probably null
R4134:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4135:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4670:Zfp729a UTSW 13 67621415 nonsense probably null
R4793:Zfp729a UTSW 13 67620427 missense probably damaging 1.00
R5009:Zfp729a UTSW 13 67620246 missense probably benign 0.01
R5125:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5178:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5438:Zfp729a UTSW 13 67619586 missense possibly damaging 0.94
R6540:Zfp729a UTSW 13 67619648 missense possibly damaging 0.81
R6731:Zfp729a UTSW 13 67620146 missense probably benign 0.09
R6987:Zfp729a UTSW 13 67619939 nonsense probably null
R7001:Zfp729a UTSW 13 67620349 missense probably benign 0.31
R7626:Zfp729a UTSW 13 67620318 nonsense probably null
R7706:Zfp729a UTSW 13 67623493 missense possibly damaging 0.72
R7855:Zfp729a UTSW 13 67619948 missense possibly damaging 0.94
R7864:Zfp729a UTSW 13 67621450 missense probably benign 0.34
R7916:Zfp729a UTSW 13 67620175 missense probably benign 0.20
R8061:Zfp729a UTSW 13 67620089 missense probably benign
R8187:Zfp729a UTSW 13 67621799 nonsense probably null
R8191:Zfp729a UTSW 13 67621719 missense probably benign 0.01
R8469:Zfp729a UTSW 13 67621362 missense probably damaging 1.00
R8733:Zfp729a UTSW 13 67620985 missense probably damaging 0.96
R8911:Zfp729a UTSW 13 67619942 missense probably benign 0.25
X0010:Zfp729a UTSW 13 67621782 missense probably damaging 0.98
Z1177:Zfp729a UTSW 13 67620231 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATTGTAGGGTTTCTCTCCAGTGTG -3'
(R):5'- AACCCTACAAGTGTGAAGTGTG -3'

Sequencing Primer
(F):5'- GCCACATTCTTCACACTTGTAGGG -3'
(R):5'- GGCAAGGCCTTCTGCATTC -3'
Posted On2020-07-28