Incidental Mutation 'R8275:Oxa1l'
ID637956
Institutional Source Beutler Lab
Gene Symbol Oxa1l
Ensembl Gene ENSMUSG00000000959
Gene Nameoxidase assembly 1-like
Synonyms1810020M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54360834-54369673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54363301 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 77 (I77N)
Ref Sequence ENSEMBL: ENSMUSP00000000985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000985
AA Change: I77N

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000985
Gene: ENSMUSG00000000959
AA Change: I77N

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:60KD_IMP 135 330 4.1e-28 PFAM
low complexity region 406 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228567
Predicted Effect probably benign
Transcript: ENSMUST00000228719
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved protein that is localized to the inner mitochondrial membrane. The encoded protein is essential for the translocation of the N-terminal tail of subunit 2 of cytochrome c oxidase, and is involved in the assembly of the cytochrome c oxidase and ATPase complexes of the mitochondrial respiratory chain. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Oxa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Oxa1l APN 14 54363345 nonsense probably null
R0196:Oxa1l UTSW 14 54363487 missense probably damaging 1.00
R0541:Oxa1l UTSW 14 54368189 missense possibly damaging 0.80
R1773:Oxa1l UTSW 14 54363452 missense probably benign 0.01
R2197:Oxa1l UTSW 14 54361467 missense probably benign 0.29
R5652:Oxa1l UTSW 14 54366832 nonsense probably null
R5850:Oxa1l UTSW 14 54367664 missense possibly damaging 0.87
R5898:Oxa1l UTSW 14 54363301 missense possibly damaging 0.50
R6088:Oxa1l UTSW 14 54367694 critical splice donor site probably null
R6162:Oxa1l UTSW 14 54368332 missense probably damaging 1.00
R6869:Oxa1l UTSW 14 54366738 missense probably damaging 1.00
R7244:Oxa1l UTSW 14 54360855 start codon destroyed probably benign 0.33
R7247:Oxa1l UTSW 14 54360855 start codon destroyed probably benign 0.33
R7317:Oxa1l UTSW 14 54360855 start codon destroyed probably benign 0.33
R7562:Oxa1l UTSW 14 54363477 missense probably damaging 1.00
R7939:Oxa1l UTSW 14 54367419 missense probably benign 0.00
R8018:Oxa1l UTSW 14 54363300 missense not run
R8245:Oxa1l UTSW 14 54367817 missense probably damaging 1.00
R8483:Oxa1l UTSW 14 54368544 splice site probably null
R8679:Oxa1l UTSW 14 54367791 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTTAAGTTATCCTGCTAGAGGC -3'
(R):5'- CTTACACGTGGCAATGGCTC -3'

Sequencing Primer
(F):5'- CACCATTGGCCATCATTG -3'
(R):5'- TGGCAATGGCTCCCCAC -3'
Posted On2020-07-28