Incidental Mutation 'R8275:Mettl22'
ID637957
Institutional Source Beutler Lab
Gene Symbol Mettl22
Ensembl Gene ENSMUSG00000039345
Gene Namemethyltransferase like 22
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location8470788-8490684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8485928 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 286 (V286A)
Ref Sequence ENSEMBL: ENSMUSP00000044108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046470] [ENSMUST00000142899] [ENSMUST00000150790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046470
AA Change: V286A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044108
Gene: ENSMUSG00000039345
AA Change: V286A

DomainStartEndE-ValueType
Pfam:Methyltransf_16 154 337 4.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142899
SMART Domains Protein: ENSMUSP00000120894
Gene: ENSMUSG00000039345

DomainStartEndE-ValueType
Pfam:Methyltransf_16 116 209 9.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150790
AA Change: V72A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114563
Gene: ENSMUSG00000039345
AA Change: V72A

DomainStartEndE-ValueType
Pfam:Methyltransf_16 1 118 2.9e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-histone lysine methyltransferases. It interacts with its substrate, Kin17, which is involved in DNA repair and replication and mRNA processing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Mettl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Mettl22 APN 16 8484253 splice site probably benign
IGL02178:Mettl22 APN 16 8478282 missense probably benign 0.01
IGL02632:Mettl22 APN 16 8484253 splice site probably benign
R0535:Mettl22 UTSW 16 8484346 splice site probably benign
R0840:Mettl22 UTSW 16 8482157 missense probably damaging 0.99
R1473:Mettl22 UTSW 16 8473961 missense probably damaging 1.00
R2422:Mettl22 UTSW 16 8487361 missense probably damaging 0.99
R5166:Mettl22 UTSW 16 8478251 missense probably benign 0.03
R5236:Mettl22 UTSW 16 8488733 nonsense probably null
R6488:Mettl22 UTSW 16 8487361 missense probably damaging 0.99
R6492:Mettl22 UTSW 16 8488891 splice site probably null
R7179:Mettl22 UTSW 16 8478060 missense probably benign 0.00
R7770:Mettl22 UTSW 16 8485900 missense possibly damaging 0.93
R8159:Mettl22 UTSW 16 8488769 missense probably benign 0.24
R8810:Mettl22 UTSW 16 8485928 missense probably damaging 1.00
R8815:Mettl22 UTSW 16 8482314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCAGCTCAACCTTGTCTC -3'
(R):5'- GGGCTGGCAGAGTCCTGA -3'

Sequencing Primer
(F):5'- AACCTTGTCTCTTGTTCCGAAG -3'
(R):5'- TCTAGGTCATTCCAGAGGTCACAAG -3'
Posted On2020-07-28