Incidental Mutation 'R8275:Mcm4'
ID637958
Institutional Source Beutler Lab
Gene Symbol Mcm4
Ensembl Gene ENSMUSG00000022673
Gene Nameminichromosome maintenance complex component 4
SynonymsmCdc21, 19G, Cdc21, Mcmd4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8275 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location15623897-15637400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15634571 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 233 (I233V)
Ref Sequence ENSEMBL: ENSMUSP00000023353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023352] [ENSMUST00000023353]
Predicted Effect probably benign
Transcript: ENSMUST00000023352
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000023353
AA Change: I233V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: I233V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
MCM 266 769 N/A SMART
AAA 501 653 7.04e-3 SMART
Blast:MCM 781 849 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Mcm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Mcm4 APN 16 15626131 missense probably damaging 1.00
IGL01982:Mcm4 APN 16 15630420 missense possibly damaging 0.57
IGL02382:Mcm4 APN 16 15624738 missense probably damaging 1.00
PIT4687001:Mcm4 UTSW 16 15636713 missense probably benign 0.01
R0200:Mcm4 UTSW 16 15629639 missense probably benign 0.41
R0540:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R0607:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R2064:Mcm4 UTSW 16 15634469 missense possibly damaging 0.75
R4240:Mcm4 UTSW 16 15627706 nonsense probably null
R4604:Mcm4 UTSW 16 15629663 missense probably damaging 1.00
R4871:Mcm4 UTSW 16 15634510 nonsense probably null
R5070:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R5125:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5178:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5245:Mcm4 UTSW 16 15630425 missense probably benign 0.02
R5513:Mcm4 UTSW 16 15630514 missense probably benign 0.26
R5696:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R6453:Mcm4 UTSW 16 15630409 missense probably damaging 1.00
R6753:Mcm4 UTSW 16 15629362 missense possibly damaging 0.91
R6909:Mcm4 UTSW 16 15628697 missense probably damaging 1.00
R6937:Mcm4 UTSW 16 15636335 missense probably benign
R7402:Mcm4 UTSW 16 15637178 start codon destroyed probably null
R7483:Mcm4 UTSW 16 15630442 missense probably benign 0.05
Z1177:Mcm4 UTSW 16 15629454 missense probably damaging 1.00
Z1177:Mcm4 UTSW 16 15632216 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATGCTACACAATCCTTGAGATCTC -3'
(R):5'- GAGCAGTTTTGTAGTTGAAGAGAAC -3'

Sequencing Primer
(F):5'- CTTGAGATCTCTTTCTACATAAGGC -3'
(R):5'- GAGAACCTTGAACTCCTGATTCTGTG -3'
Posted On2020-07-28