Incidental Mutation 'R8275:Cyp2c54'
ID 637961
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 067698-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8275 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40026749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 469 (I469L)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably benign
Transcript: ENSMUST00000048959
AA Change: I469L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: I469L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alx1 T C 10: 102,864,250 (GRCm39) D73G probably benign Het
Asah1 G A 8: 41,801,159 (GRCm39) H156Y probably damaging Het
Cgn G A 3: 94,682,263 (GRCm39) L439F possibly damaging Het
Creb1 C A 1: 64,597,687 (GRCm39) T7K probably benign Het
Cyp2s1 T A 7: 25,508,735 (GRCm39) T236S probably benign Het
Duox1 T C 2: 122,175,249 (GRCm39) I1349T probably benign Het
Efhd2 C T 4: 141,602,073 (GRCm39) A36T probably benign Het
Espl1 G A 15: 102,211,188 (GRCm39) probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat3 T A 9: 16,158,046 (GRCm39) Q1188L probably damaging Het
Flt1 A T 5: 147,614,957 (GRCm39) Y330N probably damaging Het
Golga4 A T 9: 118,361,627 (GRCm39) S202C probably damaging Het
Htr2b C T 1: 86,030,294 (GRCm39) D134N probably damaging Het
Katna1 T A 10: 7,628,574 (GRCm39) C268S probably damaging Het
Lama4 T C 10: 38,948,807 (GRCm39) Y857H probably damaging Het
Lyst T C 13: 13,950,667 (GRCm39) I3741T probably benign Het
Mcm4 T C 16: 15,452,435 (GRCm39) I233V probably damaging Het
Mettl22 T C 16: 8,303,792 (GRCm39) V286A possibly damaging Het
Nav3 C A 10: 109,527,984 (GRCm39) G1503V noncoding transcript Het
Obox1 T A 7: 15,290,153 (GRCm39) N165K probably damaging Het
Or11g2 T A 14: 50,855,868 (GRCm39) M63K probably damaging Het
Oxa1l T A 14: 54,600,758 (GRCm39) I77N possibly damaging Het
Pakap T C 4: 57,886,329 (GRCm39) probably null Het
Papss2 T C 19: 32,615,760 (GRCm39) L164P probably damaging Het
Pikfyve T A 1: 65,292,501 (GRCm39) probably benign Het
Polr2a G A 11: 69,638,882 (GRCm39) R51C probably damaging Het
Rsph10b C G 5: 143,903,323 (GRCm39) T606S possibly damaging Het
Siglecg T C 7: 43,061,892 (GRCm39) V546A probably benign Het
Slc22a29 T C 19: 8,146,681 (GRCm39) S374G probably benign Het
Tia1 C T 6: 86,404,718 (GRCm39) Q318* probably null Het
Trpm2 T A 10: 77,801,859 (GRCm39) K69* probably null Het
Unc80 C T 1: 66,679,773 (GRCm39) R2115* probably null Het
Usp35 A G 7: 96,964,026 (GRCm39) S436P probably damaging Het
Vmn1r220 A T 13: 23,368,483 (GRCm39) L71* probably null Het
Vmn2r15 A T 5: 109,434,150 (GRCm39) D851E probably benign Het
Vps33a A T 5: 123,707,522 (GRCm39) D148E probably damaging Het
Zfp729a G A 13: 67,768,223 (GRCm39) H669Y probably benign Het
Zfp804b C T 5: 6,822,289 (GRCm39) R258Q probably benign Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGGTCCATATCATCACAGCATATGG -3'
(R):5'- TCTCAGGCTGACACTTGTG -3'

Sequencing Primer
(F):5'- GAACAGTCAAAAATATTTGTGCAGG -3'
(R):5'- TCTCAGGCTGACACTTGTGAATAAGG -3'
Posted On 2020-07-28