Incidental Mutation 'R8275:Cyp2c54'
ID637961
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40037941-40073811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40038305 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 469 (I469L)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
Predicted Effect probably benign
Transcript: ENSMUST00000048959
AA Change: I469L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: I469L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Asah1 G A 8: 41,348,122 H156Y probably damaging Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40072078 missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40047543 missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40072365 critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40070228 missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40047658 splice site probably benign
R0097:Cyp2c54 UTSW 19 40047659 splice site probably benign
R0391:Cyp2c54 UTSW 19 40072169 missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40047555 missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40047635 missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40046185 missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40047588 missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40070343 missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40072423 missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40046255 missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40072171 missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40038259 missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40072141 missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40072474 missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40072414 missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40073762 missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40047561 missense probably benign
R6754:Cyp2c54 UTSW 19 40071560 missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40070259 missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40046192 missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40046182 missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40047509 missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40070253 nonsense probably null
R7535:Cyp2c54 UTSW 19 40070272 missense probably benign
R7838:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40073732 frame shift probably null
R8340:Cyp2c54 UTSW 19 40072387 missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40073681 missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40070264 missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40071546 missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40038413 missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40047586 missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40073783 missense probably benign 0.00
Z1176:Cyp2c54 UTSW 19 40046215 missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40073757 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGGTCCATATCATCACAGCATATGG -3'
(R):5'- TCTCAGGCTGACACTTGTG -3'

Sequencing Primer
(F):5'- GAACAGTCAAAAATATTTGTGCAGG -3'
(R):5'- TCTCAGGCTGACACTTGTGAATAAGG -3'
Posted On2020-07-28