Incidental Mutation 'R8276:Acbd5'
ID637965
Institutional Source Beutler Lab
Gene Symbol Acbd5
Ensembl Gene ENSMUSG00000026781
Gene Nameacyl-Coenzyme A binding domain containing 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location23068167-23115558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23069551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 39 (D39G)
Ref Sequence ENSEMBL: ENSMUSP00000110175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028121] [ENSMUST00000114523] [ENSMUST00000114526] [ENSMUST00000114529] [ENSMUST00000144088] [ENSMUST00000155602]
Predicted Effect probably benign
Transcript: ENSMUST00000028121
AA Change: D3G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028121
Gene: ENSMUSG00000026781
AA Change: D3G

DomainStartEndE-ValueType
Pfam:ACBP 8 96 3.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 392 414 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114523
AA Change: D3G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110169
Gene: ENSMUSG00000026781
AA Change: D3G

DomainStartEndE-ValueType
Pfam:ACBP 8 96 2.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 393 415 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114526
AA Change: D39G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110172
Gene: ENSMUSG00000026781
AA Change: D39G

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 44 132 4.7e-35 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 428 450 N/A INTRINSIC
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114529
AA Change: D39G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110175
Gene: ENSMUSG00000026781
AA Change: D39G

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 45 129 4.9e-30 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 429 451 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144088
AA Change: D3G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121395
Gene: ENSMUSG00000026781
AA Change: D3G

DomainStartEndE-ValueType
Pfam:ACBP 8 52 4.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155602
AA Change: D3G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117325
Gene: ENSMUSG00000026781
AA Change: D3G

DomainStartEndE-ValueType
Pfam:ACBP 8 96 3.5e-36 PFAM
low complexity region 117 130 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-Coenzyme A binding protein family, known to function in the transport and distribution of long chain acyl-Coenzyme A in cells. This gene may play a role in the differentiation of megakaryocytes and formation of platelets. A related protein in yeast is involved in autophagy of peroxisomes. A mutation in this gene has been associated with autosomal dominant thrombocytopenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Acbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Acbd5 APN 2 23078169 missense probably damaging 1.00
IGL02343:Acbd5 APN 2 23087495 missense possibly damaging 0.89
IGL03087:Acbd5 APN 2 23089710 missense probably benign
R0723:Acbd5 UTSW 2 23069596 missense probably damaging 1.00
R1428:Acbd5 UTSW 2 23099721 missense probably damaging 0.99
R1610:Acbd5 UTSW 2 23090551 missense probably damaging 1.00
R1623:Acbd5 UTSW 2 23094344 missense probably damaging 1.00
R2918:Acbd5 UTSW 2 23099567 missense probably benign 0.00
R4736:Acbd5 UTSW 2 23099584 missense probably damaging 0.96
R5369:Acbd5 UTSW 2 23112510 missense probably damaging 0.96
R6207:Acbd5 UTSW 2 23069478 missense possibly damaging 0.58
R6599:Acbd5 UTSW 2 23069080 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGATTGGGCAGGCAAAG -3'
(R):5'- GATAATACGTCGCCTTTGGC -3'

Sequencing Primer
(F):5'- GGGGAATTGACCAGCTATGCTC -3'
(R):5'- TTTGGCCTCAAAAATCAGCGG -3'
Posted On2020-07-28