Incidental Mutation 'R8276:Kcnmb3'
ID637968
Institutional Source Beutler Lab
Gene Symbol Kcnmb3
Ensembl Gene ENSMUSG00000091091
Gene Namepotassium large conductance calcium-activated channel, subfamily M, beta member 3
SynonymsGm5707
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32471588-32492231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32482423 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 52 (L52P)
Ref Sequence ENSEMBL: ENSMUSP00000130177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164954]
Predicted Effect probably damaging
Transcript: ENSMUST00000164954
AA Change: L52P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130177
Gene: ENSMUSG00000091091
AA Change: L52P

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Pfam:CaKB 41 232 2.6e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which may partially inactivate or slightly decrease the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 22. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Kcnmb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1965:Kcnmb3 UTSW 3 32472343 missense probably damaging 1.00
R2036:Kcnmb3 UTSW 3 32472382 missense probably damaging 1.00
R4917:Kcnmb3 UTSW 3 32472504 nonsense probably null
R5593:Kcnmb3 UTSW 3 32491947 missense possibly damaging 0.92
R6153:Kcnmb3 UTSW 3 32473827 missense probably damaging 1.00
R6659:Kcnmb3 UTSW 3 32472445 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAGCAGAGGACTATTTCACAC -3'
(R):5'- TCTCAGTGAACCAGACTCAGG -3'

Sequencing Primer
(F):5'- TGTCTCCAGCACGAACAGG -3'
(R):5'- GACTCAGGTTTGCCATGAGCTAAAC -3'
Posted On2020-07-28