Incidental Mutation 'R8276:Rbm46'
ID637969
Institutional Source Beutler Lab
Gene Symbol Rbm46
Ensembl Gene ENSMUSG00000033882
Gene NameRNA binding motif protein 46
SynonymsENSMUSG00000033882, LOC329687
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location82837228-82876483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82864588 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 240 (V240A)
Ref Sequence ENSEMBL: ENSMUSP00000045511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048647] [ENSMUST00000182637] [ENSMUST00000182818]
Predicted Effect probably damaging
Transcript: ENSMUST00000048647
AA Change: V240A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045511
Gene: ENSMUSG00000033882
AA Change: V240A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 9.4e-30 PFAM
low complexity region 494 514 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182637
AA Change: V240A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138728
Gene: ENSMUSG00000033882
AA Change: V240A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 1.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182818
AA Change: V240A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138429
Gene: ENSMUSG00000033882
AA Change: V240A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 2.1e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Rbm46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Rbm46 APN 3 82864416 missense possibly damaging 0.85
R0048:Rbm46 UTSW 3 82864230 missense probably damaging 0.96
R0554:Rbm46 UTSW 3 82865268 missense probably damaging 1.00
R1606:Rbm46 UTSW 3 82864541 missense probably damaging 1.00
R2200:Rbm46 UTSW 3 82864044 missense probably benign 0.00
R2357:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4646:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4647:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4648:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R5584:Rbm46 UTSW 3 82864158 missense probably benign
R5722:Rbm46 UTSW 3 82865333 missense possibly damaging 0.95
R6393:Rbm46 UTSW 3 82863955 missense probably benign 0.03
R7228:Rbm46 UTSW 3 82842533 missense probably benign
R7438:Rbm46 UTSW 3 82842488 nonsense probably null
R7445:Rbm46 UTSW 3 82864210 missense probably damaging 0.99
R7452:Rbm46 UTSW 3 82864121 missense probably benign 0.01
R8195:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8196:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8211:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8212:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8235:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8239:Rbm46 UTSW 3 82865468 missense probably benign 0.01
Z1177:Rbm46 UTSW 3 82837318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTCGCCAAGTATTTTCC -3'
(R):5'- ATATGTCACTCTTTAGACGTGGC -3'

Sequencing Primer
(F):5'- TGCCAGGGTTACCTCAATACTGG -3'
(R):5'- ACTCTTTAGACGTGGCATTCTTTG -3'
Posted On2020-07-28