Incidental Mutation 'R8276:Zfp618'
ID637971
Institutional Source Beutler Lab
Gene Symbol Zfp618
Ensembl Gene ENSMUSG00000028358
Gene Namezinc finger protein 618
SynonymsD430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location62965573-63139708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63132956 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 658 (H658R)
Ref Sequence ENSEMBL: ENSMUSP00000103038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064814] [ENSMUST00000107415]
Predicted Effect probably damaging
Transcript: ENSMUST00000064814
AA Change: H565R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069275
Gene: ENSMUSG00000028358
AA Change: H565R

DomainStartEndE-ValueType
ZnF_C2H2 114 136 5.06e-2 SMART
ZnF_C2H2 155 177 8.81e-2 SMART
ZnF_C2H2 243 265 2.91e-2 SMART
low complexity region 288 295 N/A INTRINSIC
ZnF_C2H2 298 320 2.53e-2 SMART
PDB:2BW3|A 377 690 5e-8 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107415
AA Change: H658R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103038
Gene: ENSMUSG00000028358
AA Change: H658R

DomainStartEndE-ValueType
ZnF_C2H2 146 168 5.06e-2 SMART
ZnF_C2H2 187 209 8.81e-2 SMART
ZnF_C2H2 255 277 2.91e-2 SMART
low complexity region 381 388 N/A INTRINSIC
ZnF_C2H2 391 413 2.53e-2 SMART
PDB:2BW3|A 479 783 9e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Zfp618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp618 APN 4 63132826 missense probably damaging 1.00
IGL01563:Zfp618 APN 4 63079896 missense probably benign 0.38
IGL01726:Zfp618 APN 4 63132635 missense probably damaging 1.00
IGL02139:Zfp618 APN 4 63133536 missense probably damaging 1.00
IGL02182:Zfp618 APN 4 63095561 splice site probably benign
IGL02533:Zfp618 APN 4 63089405 missense probably damaging 1.00
IGL03231:Zfp618 APN 4 63094479 missense probably damaging 1.00
IGL03257:Zfp618 APN 4 63132671 missense probably damaging 1.00
ANU18:Zfp618 UTSW 4 63132826 missense probably damaging 1.00
IGL03014:Zfp618 UTSW 4 63080088 missense probably damaging 1.00
R0288:Zfp618 UTSW 4 63132934 missense possibly damaging 0.57
R0408:Zfp618 UTSW 4 63086572 missense probably damaging 0.97
R0685:Zfp618 UTSW 4 63133774 missense probably benign 0.21
R1482:Zfp618 UTSW 4 63115448 missense possibly damaging 0.64
R1585:Zfp618 UTSW 4 63132938 missense probably damaging 1.00
R1649:Zfp618 UTSW 4 63095537 missense probably damaging 1.00
R1744:Zfp618 UTSW 4 63086634 splice site probably benign
R1793:Zfp618 UTSW 4 63133237 missense probably damaging 0.97
R1952:Zfp618 UTSW 4 63132318 splice site probably null
R1996:Zfp618 UTSW 4 63131215 splice site probably null
R3792:Zfp618 UTSW 4 63115491 intron probably benign
R3803:Zfp618 UTSW 4 63133019 missense probably damaging 1.00
R3821:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R3838:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4009:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4010:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4565:Zfp618 UTSW 4 63121351 missense probably damaging 1.00
R4611:Zfp618 UTSW 4 63132979 missense probably damaging 1.00
R5019:Zfp618 UTSW 4 63103552 missense probably damaging 1.00
R5154:Zfp618 UTSW 4 63133209 missense probably damaging 1.00
R5183:Zfp618 UTSW 4 63099282 missense probably benign
R5354:Zfp618 UTSW 4 63080028 missense probably damaging 1.00
R5383:Zfp618 UTSW 4 63095492 missense probably benign 0.33
R5774:Zfp618 UTSW 4 63132562 missense probably damaging 1.00
R5932:Zfp618 UTSW 4 63118566 nonsense probably null
R6101:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6105:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6478:Zfp618 UTSW 4 63132706 missense probably damaging 1.00
R6598:Zfp618 UTSW 4 63089399 missense probably damaging 1.00
R7386:Zfp618 UTSW 4 63095385 critical splice donor site probably null
R7666:Zfp618 UTSW 4 63132717 nonsense probably null
R7678:Zfp618 UTSW 4 63086621 missense probably benign 0.07
R7975:Zfp618 UTSW 4 63131115 missense possibly damaging 0.93
R8421:Zfp618 UTSW 4 63133246 missense probably damaging 1.00
X0011:Zfp618 UTSW 4 63080006 missense probably damaging 0.99
Z1176:Zfp618 UTSW 4 63095497 missense probably benign 0.29
Z1176:Zfp618 UTSW 4 63132763 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGTGGTGACTTGGTGCATCAC -3'
(R):5'- TGAGGTTCATCTTCTTGGCAC -3'

Sequencing Primer
(F):5'- TGCATCACTGGGTGCAGAAC -3'
(R):5'- CTTCTTGGCACGGCTGTAGAAC -3'
Posted On2020-07-28