Mutagenetix > Incidental Mutation

Incidental Mutation 'R8276:Ptpru'

637973

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8276 (G1)

Quality Score

118.008

Status

Validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 131779173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1026 (G1026D)

Ref Sequence

ENSEMBL: ENSMUSP00000101607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]

AlphaFold

B1AUH1

Predicted Effect

probably damaging
Transcript: ENSMUST00000030741
AA Change: G1036D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: G1036D

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097860

SMART Domains

Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909

Domain	Start	End	E-Value	Type
Pfam:MAM	1	116	4.1e-30	PFAM
IG	123	211	4.93e-3	SMART
FN3	213	296	3.79e-2	SMART
FN3	312	400	2.5e-2	SMART
FN3	416	504	3.62e-8	SMART
low complexity region	555	569	N/A	INTRINSIC
low complexity region	595	605	N/A	INTRINSIC
transmembrane domain	675	697	N/A	INTRINSIC
Blast:PTPc	736	878	3e-49	BLAST
SCOP:d1jlna_	790	886	9e-19	SMART
PDB:2C7S\|A	797	878	7e-22	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000105987
AA Change: G1026D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: G1026D

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Meta Mutation Damage Score

0.4101

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,663,928	R27W	probably damaging	Het
Acbd5	A	G	2: 23,069,551	D39G	probably benign	Het
Amdhd2	C	G	17: 24,163,600	R22P	probably damaging	Het
Ankmy1	T	C	1: 92,886,809	I325M	probably benign	Het
Cyld	A	G	8: 88,734,928	I664M	probably benign	Het
Dnajc10	T	C	2: 80,349,270	M716T	probably benign	Het
Dock10	T	A	1: 80,528,281	T1743S	probably benign	Het
Dopey1	T	C	9: 86,517,039	S947P	probably benign	Het
Ep300	C	G	15: 81,650,028	N2095K	possibly damaging	Het
Evi2a	T	A	11: 79,527,490	N98I	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Far2	G	T	6: 148,173,901	V420L	probably benign	Het
Gng5	A	G	3: 146,500,503		probably benign	Het
Heatr5b	G	A	17: 78,791,539	R1311*	probably null	Het
Hhipl2	A	T	1: 183,436,419	K478M	possibly damaging	Het
Hs3st1	A	T	5: 39,614,803	Y166N	probably damaging	Het
Jcad	T	A	18: 4,674,318	S693R	probably damaging	Het
Kcnmb3	A	G	3: 32,482,423	L52P	probably damaging	Het
Mib1	T	C	18: 10,751,880	I254T	possibly damaging	Het
Myo18b	T	C	5: 112,795,407	K1644R	possibly damaging	Het
Nlrp2	G	A	7: 5,317,495	T881M	probably benign	Het
Olfr651	A	T	7: 104,553,315	Y132F	probably damaging	Het
Olfr748	T	A	14: 50,710,830	S167T	probably benign	Het
Pkd1l3	A	C	8: 109,670,721	*2152C	probably null	Het
Polr2a	G	A	11: 69,748,056	R51C	probably damaging	Het
Rbm46	A	G	3: 82,864,588	V240A	probably damaging	Het
Rrm1	G	A	7: 102,460,852		probably null	Het
Ryr3	T	C	2: 112,640,617	D4637G	probably damaging	Het
Selenos	G	A	7: 66,079,804		probably benign	Het
Serpina1e	G	T	12: 103,947,169	T364K	probably damaging	Het
Shroom3	A	T	5: 92,940,480	Q363L	probably damaging	Het
Slc9a3r2	G	T	17: 24,642,260	Y175*	probably null	Het
Slc9b1	A	C	3: 135,371,897	E139D	possibly damaging	Het
Tjp1	A	T	7: 65,343,796		probably benign	Het
Tmcc3	A	T	10: 94,582,308	T344S	probably damaging	Het
Tnrc6b	T	A	15: 80,880,717	S807T	probably benign	Het
Trav7-6	A	T	14: 53,717,238	H95L	probably benign	Het
Trmu	T	A	15: 85,882,731	V47D	possibly damaging	Het
Uba6	C	A	5: 86,142,650		probably benign	Het
Unc79	A	G	12: 103,001,863	D116G	possibly damaging	Het
Vmn2r93	G	A	17: 18,305,387		probably null	Het
Zfp541	A	T	7: 16,079,084	H554L	possibly damaging	Het
Zfp618	A	G	4: 63,132,956	H658R	probably damaging	Het
Zmym1	A	T	4: 127,054,258	Y107N	probably damaging	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0503:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1624:Ptpru	UTSW	4	131772550	missense	probably damaging	1.00
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2051:Ptpru	UTSW	4	131819087	missense	possibly damaging	0.80
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5279:Ptpru	UTSW	4	131820023	missense	possibly damaging	0.62
R5464:Ptpru	UTSW	4	131772557	missense	probably damaging	1.00
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5802:Ptpru	UTSW	4	131788377	missense	possibly damaging	0.84
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5953:Ptpru	UTSW	4	131776837	missense	probably damaging	1.00
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
R7736:Ptpru	UTSW	4	131788382	missense	probably damaging	1.00
R7960:Ptpru	UTSW	4	131788509	missense	probably benign	0.01
R8094:Ptpru	UTSW	4	131793592	missense	possibly damaging	0.88
R8262:Ptpru	UTSW	4	131794963	nonsense	probably null
R8355:Ptpru	UTSW	4	131808500	missense	probably damaging	1.00
R8377:Ptpru	UTSW	4	131808335	missense	probably damaging	1.00
R8416:Ptpru	UTSW	4	131808472	missense	probably damaging	1.00
R8858:Ptpru	UTSW	4	131799514	splice site	probably benign
R8911:Ptpru	UTSW	4	131776249	missense	probably damaging	0.96
R8934:Ptpru	UTSW	4	131818986	missense	probably damaging	0.98
R9031:Ptpru	UTSW	4	131788380	missense	probably damaging	1.00
R9069:Ptpru	UTSW	4	131776254	missense	possibly damaging	0.87
R9096:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9097:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9151:Ptpru	UTSW	4	131794967	missense	probably benign
R9166:Ptpru	UTSW	4	131797869	missense	probably benign	0.00
R9174:Ptpru	UTSW	4	131808435	missense	probably damaging	1.00
R9242:Ptpru	UTSW	4	131803030	missense	probably damaging	1.00
R9698:Ptpru	UTSW	4	131820220	missense	probably benign	0.09
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15
Z1177:Ptpru	UTSW	4	131799706	missense	probably benign	0.00
Z1177:Ptpru	UTSW	4	131808262	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTAGGGACCATGAACCTACGC -3'
(R):5'- CATCTGGTGGACTCAGTGTG -3'

Sequencing Primer
(F):5'- GGACCATGAACCTACGCCACTC -3'
(R):5'- TGGACTCAGTGTGTGCAC -3'

Posted On

2020-07-28