Incidental Mutation 'R8276:Far2'
ID637977
Institutional Source Beutler Lab
Gene Symbol Far2
Ensembl Gene ENSMUSG00000030303
Gene Namefatty acyl CoA reductase 2
SynonymsMlstd1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location148047259-148182758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 148173901 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 420 (V420L)
Ref Sequence ENSEMBL: ENSMUSP00000032443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032443] [ENSMUST00000111607]
Predicted Effect probably benign
Transcript: ENSMUST00000032443
AA Change: V420L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032443
Gene: ENSMUSG00000030303
AA Change: V420L

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 160 5.3e-8 PFAM
Pfam:Epimerase 13 242 7.5e-9 PFAM
Pfam:3Beta_HSD 14 167 3.4e-7 PFAM
Pfam:NAD_binding_4 15 285 3.3e-76 PFAM
Pfam:Sterile 356 448 4.3e-35 PFAM
transmembrane domain 465 484 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111607
AA Change: V420L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107234
Gene: ENSMUSG00000030303
AA Change: V420L

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.9e-8 PFAM
Pfam:Epimerase 13 241 3.2e-10 PFAM
Pfam:3Beta_HSD 14 167 4.2e-7 PFAM
Pfam:NAD_binding_4 15 285 3.2e-73 PFAM
Pfam:Sterile 355 448 1.2e-29 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the short chain dehydrogenase/reductase superfamily. It encodes a reductase enzyme involved in the first step of wax biosynthesis wherein fatty acids are converted to fatty alcohols. The encoded peroxisomal protein utilizes saturated fatty acids of 16 or 18 carbons as preferred substrates. Alternatively spliced transcript variants have been observed for this gene. Related pseudogenes have been identified on chromosomes 2, 14 and 22. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Far2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Far2 APN 6 148150598 missense possibly damaging 0.89
IGL01650:Far2 APN 6 148173487 missense possibly damaging 0.92
IGL01899:Far2 APN 6 148146029 missense probably benign 0.19
IGL02524:Far2 APN 6 148150658 missense probably damaging 1.00
IGL02756:Far2 APN 6 148157391 missense probably damaging 1.00
Galway UTSW 6 148157482 missense probably damaging 0.99
PIT4531001:Far2 UTSW 6 148175131 missense possibly damaging 0.95
R0319:Far2 UTSW 6 148157470 missense probably damaging 0.96
R0654:Far2 UTSW 6 148175141 missense possibly damaging 0.64
R1321:Far2 UTSW 6 148173536 splice site probably benign
R1610:Far2 UTSW 6 148157458 missense possibly damaging 0.71
R2039:Far2 UTSW 6 148165577 missense probably benign
R2471:Far2 UTSW 6 148138694 missense probably damaging 1.00
R3874:Far2 UTSW 6 148150591 missense probably benign 0.00
R3875:Far2 UTSW 6 148150591 missense probably benign 0.00
R3974:Far2 UTSW 6 148150754 missense probably damaging 0.96
R4490:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R4491:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R5034:Far2 UTSW 6 148173441 missense probably benign 0.43
R5421:Far2 UTSW 6 148146192 splice site probably null
R5673:Far2 UTSW 6 148146104 missense possibly damaging 0.86
R6092:Far2 UTSW 6 148175083 missense probably benign 0.00
R6294:Far2 UTSW 6 148157482 missense probably damaging 0.99
R6325:Far2 UTSW 6 148157497 missense probably benign 0.30
R6783:Far2 UTSW 6 148150775 splice site probably null
R7380:Far2 UTSW 6 148180995 missense unknown
R7403:Far2 UTSW 6 148158977 missense possibly damaging 0.93
R7484:Far2 UTSW 6 148173913 missense probably damaging 1.00
X0053:Far2 UTSW 6 148165640 missense probably benign 0.00
Z1088:Far2 UTSW 6 148138658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACAGCTAAGAGACCTTGTCTG -3'
(R):5'- CAGCAGTAGAACCTCACAGATG -3'

Sequencing Primer
(F):5'- CAGCTAAGAGACCTTGTCTGTGAAC -3'
(R):5'- ATGGATACCAGTGAGTGTGCCTAC -3'
Posted On2020-07-28