Incidental Mutation 'R8276:Zfp541'
ID637979
Institutional Source Beutler Lab
Gene Symbol Zfp541
Ensembl Gene ENSMUSG00000078796
Gene Namezinc finger protein 541
SynonymsEG666528
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16061814-16096334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16079084 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 554 (H554L)
Ref Sequence ENSEMBL: ENSMUSP00000104149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108509] [ENSMUST00000209369] [ENSMUST00000210805]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108509
AA Change: H554L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104149
Gene: ENSMUSG00000078796
AA Change: H554L

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
ZnF_C2H2 140 162 2.24e-3 SMART
ZnF_C2H2 168 190 4.47e-3 SMART
ZnF_C2H2 196 221 2.36e-2 SMART
low complexity region 249 260 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 444 465 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 594 609 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
ZnF_C2H2 838 860 3.72e0 SMART
low complexity region 953 958 N/A INTRINSIC
ELM2 1065 1122 4.46e-14 SMART
SANT 1171 1219 8.38e-7 SMART
low complexity region 1252 1263 N/A INTRINSIC
ZnF_C2H2 1301 1323 1.01e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209369
AA Change: H554L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000210805
AA Change: H554L

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Zfp541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Zfp541 APN 7 16079468 missense possibly damaging 0.80
IGL02262:Zfp541 APN 7 16079695 missense probably damaging 1.00
IGL02347:Zfp541 APN 7 16083465 missense probably damaging 1.00
IGL02516:Zfp541 APN 7 16082993 splice site probably null
R0101:Zfp541 UTSW 7 16078043 missense probably damaging 1.00
R0412:Zfp541 UTSW 7 16082174 missense possibly damaging 0.88
R0627:Zfp541 UTSW 7 16095682 splice site probably benign
R0784:Zfp541 UTSW 7 16082992 intron probably benign
R1083:Zfp541 UTSW 7 16078712 missense probably benign 0.16
R1541:Zfp541 UTSW 7 16078512 missense probably benign 0.04
R1575:Zfp541 UTSW 7 16078715 missense possibly damaging 0.94
R1730:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1783:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1966:Zfp541 UTSW 7 16079071 missense probably benign 0.02
R2022:Zfp541 UTSW 7 16082185 missense probably damaging 1.00
R2048:Zfp541 UTSW 7 16078327 missense possibly damaging 0.94
R2436:Zfp541 UTSW 7 16076448 missense possibly damaging 0.94
R3973:Zfp541 UTSW 7 16072222 missense probably damaging 1.00
R4081:Zfp541 UTSW 7 16072135 missense probably benign 0.16
R4589:Zfp541 UTSW 7 16083336 missense probably benign 0.35
R4724:Zfp541 UTSW 7 16081687 missense probably damaging 0.99
R4812:Zfp541 UTSW 7 16079110 missense probably benign 0.01
R4817:Zfp541 UTSW 7 16090382 missense probably damaging 1.00
R5232:Zfp541 UTSW 7 16095179 missense probably damaging 1.00
R5331:Zfp541 UTSW 7 16095758 missense probably damaging 1.00
R5551:Zfp541 UTSW 7 16090861 missense probably damaging 1.00
R5976:Zfp541 UTSW 7 16076419 missense probably benign 0.34
R6259:Zfp541 UTSW 7 16095526 missense probably benign 0.02
R6523:Zfp541 UTSW 7 16095520 missense probably damaging 1.00
R6826:Zfp541 UTSW 7 16078982 missense probably damaging 0.96
R7319:Zfp541 UTSW 7 16079369 missense probably benign 0.21
R7428:Zfp541 UTSW 7 16092868 missense probably damaging 1.00
R7594:Zfp541 UTSW 7 16076386 missense probably damaging 0.96
R7724:Zfp541 UTSW 7 16071994 missense probably damaging 1.00
R8433:Zfp541 UTSW 7 16072074 missense probably benign 0.16
Z1088:Zfp541 UTSW 7 16079795 missense probably benign 0.16
Z1176:Zfp541 UTSW 7 16078266 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16078763 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16079029 missense probably benign 0.26
Z1177:Zfp541 UTSW 7 16082167 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACTAAAGGCCCCTGGTGAG -3'
(R):5'- AAAGAGTCTACAGTGGGTGCTG -3'

Sequencing Primer
(F):5'- TGAGGCCTCCAGTGAAGTTC -3'
(R):5'- ACAGTGGGTGCTGGTGGC -3'
Posted On2020-07-28