Incidental Mutation 'R8276:Tmcc3'
ID637986
Institutional Source Beutler Lab
Gene Symbol Tmcc3
Ensembl Gene ENSMUSG00000020023
Gene Nametransmembrane and coiled coil domains 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location94311949-94590956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94582308 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 344 (T344S)
Ref Sequence ENSEMBL: ENSMUSP00000063264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065060] [ENSMUST00000117460] [ENSMUST00000117929] [ENSMUST00000121471] [ENSMUST00000132743] [ENSMUST00000148823] [ENSMUST00000148910]
Predicted Effect probably damaging
Transcript: ENSMUST00000065060
AA Change: T344S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063264
Gene: ENSMUSG00000020023
AA Change: T344S

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 65 465 1.2e-160 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117460
AA Change: T313S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112669
Gene: ENSMUSG00000020023
AA Change: T313S

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117929
AA Change: T313S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112401
Gene: ENSMUSG00000020023
AA Change: T313S

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121471
AA Change: T313S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113122
Gene: ENSMUSG00000020023
AA Change: T313S

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132743
SMART Domains Protein: ENSMUSP00000119751
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 47 134 3.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148823
SMART Domains Protein: ENSMUSP00000119496
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 85 210 3.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148910
SMART Domains Protein: ENSMUSP00000121456
Gene: ENSMUSG00000020023

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 34 76 1.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Tmcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Tmcc3 APN 10 94582285 missense probably damaging 1.00
IGL01455:Tmcc3 APN 10 94586755 missense probably damaging 0.97
IGL02376:Tmcc3 APN 10 94578567 missense possibly damaging 0.85
IGL03073:Tmcc3 APN 10 94578951 missense probably benign 0.40
IGL03348:Tmcc3 APN 10 94579080 missense possibly damaging 0.95
R0131:Tmcc3 UTSW 10 94545575 splice site probably benign
R0360:Tmcc3 UTSW 10 94578545 missense probably benign
R0840:Tmcc3 UTSW 10 94578771 missense probably benign 0.05
R1994:Tmcc3 UTSW 10 94578606 missense possibly damaging 0.95
R1995:Tmcc3 UTSW 10 94578606 missense possibly damaging 0.95
R2184:Tmcc3 UTSW 10 94582306 missense probably damaging 1.00
R2197:Tmcc3 UTSW 10 94578918 missense probably damaging 1.00
R2273:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R2274:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R3763:Tmcc3 UTSW 10 94579317 missense probably benign 0.42
R4690:Tmcc3 UTSW 10 94545557 utr 5 prime probably benign
R4763:Tmcc3 UTSW 10 94579311 missense probably damaging 1.00
R4816:Tmcc3 UTSW 10 94578784 missense possibly damaging 0.89
R5385:Tmcc3 UTSW 10 94579153 missense probably damaging 1.00
R6177:Tmcc3 UTSW 10 94582387 missense probably damaging 0.97
R6636:Tmcc3 UTSW 10 94578424 missense probably benign 0.14
R6898:Tmcc3 UTSW 10 94551172 splice site probably null
R7128:Tmcc3 UTSW 10 94430634 start gained probably benign
R7313:Tmcc3 UTSW 10 94430572 start gained probably benign
R7320:Tmcc3 UTSW 10 94578495 missense possibly damaging 0.94
R7456:Tmcc3 UTSW 10 94582312 missense possibly damaging 0.79
R7874:Tmcc3 UTSW 10 94551027 critical splice donor site probably null
R7876:Tmcc3 UTSW 10 94578535 missense probably benign 0.03
R8098:Tmcc3 UTSW 10 94579216 missense probably benign 0.00
R8274:Tmcc3 UTSW 10 94586876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAATTGGGATTCAGGGGTGAC -3'
(R):5'- TCATGACGGAATGCTTGGGG -3'

Sequencing Primer
(F):5'- CAGGGGTGACAAAAATTGTGTTTCC -3'
(R):5'- CGGAATGCTTGGGGAAGTGTAC -3'
Posted On2020-07-28