Incidental Mutation 'R8276:Evi2a'
ID637988
Institutional Source Beutler Lab
Gene Symbol Evi2a
Ensembl Gene ENSMUSG00000078771
Gene Nameecotropic viral integration site 2a
SynonymsEvi-2, Evi2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location79526560-79530609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79527490 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 98 (N98I)
Ref Sequence ENSEMBL: ENSMUSP00000099526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000093983] [ENSMUST00000103236] [ENSMUST00000108251] [ENSMUST00000146611] [ENSMUST00000170422] [ENSMUST00000170799] [ENSMUST00000179322]
Predicted Effect probably benign
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093983
SMART Domains Protein: ENSMUSP00000091519
Gene: ENSMUSG00000070354

DomainStartEndE-ValueType
Pfam:EVI2A 1 75 1.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103236
AA Change: N98I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099526
Gene: ENSMUSG00000078771
AA Change: N98I

DomainStartEndE-ValueType
Pfam:EVI2A 1 223 5.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146611
SMART Domains Protein: ENSMUSP00000115683
Gene: ENSMUSG00000078771

DomainStartEndE-ValueType
Pfam:EVI2A 28 59 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154415
Predicted Effect probably benign
Transcript: ENSMUST00000170422
SMART Domains Protein: ENSMUSP00000128569
Gene: ENSMUSG00000070354

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170799
AA Change: N98I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125936
Gene: ENSMUSG00000078771
AA Change: N98I

DomainStartEndE-ValueType
Pfam:EVI2A 1 223 6.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179322
SMART Domains Protein: ENSMUSP00000136153
Gene: ENSMUSG00000093938

DomainStartEndE-ValueType
low complexity region 139 152 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 391 396 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Evi2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Evi2a APN 11 79527152 missense probably damaging 1.00
IGL02093:Evi2a APN 11 79527664 missense probably benign 0.43
R1440:Evi2a UTSW 11 79527270 missense probably damaging 1.00
R1474:Evi2a UTSW 11 79527572 missense probably benign 0.21
R2062:Evi2a UTSW 11 79527767 nonsense probably null
R5135:Evi2a UTSW 11 79527451 missense possibly damaging 0.70
R7282:Evi2a UTSW 11 79527423 missense probably benign 0.43
R7788:Evi2a UTSW 11 79527942 missense unknown
R7827:Evi2a UTSW 11 79527862 unclassified probably benign
R7859:Evi2a UTSW 11 79527626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAAAGTCACCGTTGCTCC -3'
(R):5'- TCCAGTAATCAGAATGGCTCCAG -3'

Sequencing Primer
(F):5'- CTTTGACCTTTTGAGAGATGAGAC -3'
(R):5'- TCCAGCAGACATCCGAGTG -3'
Posted On2020-07-28