Mutagenetix > Incidental Mutation

Incidental Mutation 'R8276:Ep300'

637995

Institutional Source

Beutler Lab

Gene Symbol

Ep300

Ensembl Gene

ENSMUSG00000055024

Gene Name

E1A binding protein p300

Synonyms

KAT3B, p300

MMRRC Submission

067699-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81585351-81652077 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 81650028 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 2095 (N2095K)

Ref Sequence

ENSEMBL: ENSMUSP00000066789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068387]

AlphaFold

B2RWS6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068387
AA Change: N2095K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: N2095K

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
low complexity region	162	178	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	296	309	N/A	INTRINSIC
ZnF_TAZ	333	418	2.85e-32	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
Pfam:KIX	567	647	7.2e-44	PFAM
low complexity region	722	735	N/A	INTRINSIC
low complexity region	831	848	N/A	INTRINSIC
low complexity region	852	882	N/A	INTRINSIC
low complexity region	884	920	N/A	INTRINSIC
low complexity region	924	943	N/A	INTRINSIC
low complexity region	1024	1039	N/A	INTRINSIC
BROMO	1047	1157	6.36e-42	SMART
Blast:KAT11	1227	1300	9e-22	BLAST
KAT11	1305	1610	1.19e-140	SMART
ZnF_ZZ	1663	1704	2.67e-15	SMART
ZnF_TAZ	1728	1806	5.53e-30	SMART
low complexity region	1810	1836	N/A	INTRINSIC
low complexity region	1847	1881	N/A	INTRINSIC
low complexity region	1902	1927	N/A	INTRINSIC
low complexity region	1962	1979	N/A	INTRINSIC
Pfam:Creb_binding	1993	2099	3.5e-37	PFAM
low complexity region	2146	2158	N/A	INTRINSIC
low complexity region	2187	2203	N/A	INTRINSIC
low complexity region	2205	2244	N/A	INTRINSIC
low complexity region	2254	2265	N/A	INTRINSIC
low complexity region	2303	2346	N/A	INTRINSIC
low complexity region	2390	2405	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,663,928	R27W	probably damaging	Het
Acbd5	A	G	2: 23,069,551	D39G	probably benign	Het
Amdhd2	C	G	17: 24,163,600	R22P	probably damaging	Het
Ankmy1	T	C	1: 92,886,809	I325M	probably benign	Het
Cyld	A	G	8: 88,734,928	I664M	probably benign	Het
Dnajc10	T	C	2: 80,349,270	M716T	probably benign	Het
Dock10	T	A	1: 80,528,281	T1743S	probably benign	Het
Dopey1	T	C	9: 86,517,039	S947P	probably benign	Het
Evi2a	T	A	11: 79,527,490	N98I	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Far2	G	T	6: 148,173,901	V420L	probably benign	Het
Gng5	A	G	3: 146,500,503		probably benign	Het
Heatr5b	G	A	17: 78,791,539	R1311*	probably null	Het
Hhipl2	A	T	1: 183,436,419	K478M	possibly damaging	Het
Hs3st1	A	T	5: 39,614,803	Y166N	probably damaging	Het
Jcad	T	A	18: 4,674,318	S693R	probably damaging	Het
Kcnmb3	A	G	3: 32,482,423	L52P	probably damaging	Het
Mib1	T	C	18: 10,751,880	I254T	possibly damaging	Het
Myo18b	T	C	5: 112,795,407	K1644R	possibly damaging	Het
Nlrp2	G	A	7: 5,317,495	T881M	probably benign	Het
Olfr651	A	T	7: 104,553,315	Y132F	probably damaging	Het
Olfr748	T	A	14: 50,710,830	S167T	probably benign	Het
Pkd1l3	A	C	8: 109,670,721	*2152C	probably null	Het
Polr2a	G	A	11: 69,748,056	R51C	probably damaging	Het
Ptpru	C	T	4: 131,779,173	G1026D	probably damaging	Het
Rbm46	A	G	3: 82,864,588	V240A	probably damaging	Het
Rrm1	G	A	7: 102,460,852		probably null	Het
Ryr3	T	C	2: 112,640,617	D4637G	probably damaging	Het
Selenos	G	A	7: 66,079,804		probably benign	Het
Serpina1e	G	T	12: 103,947,169	T364K	probably damaging	Het
Shroom3	A	T	5: 92,940,480	Q363L	probably damaging	Het
Slc9a3r2	G	T	17: 24,642,260	Y175*	probably null	Het
Slc9b1	A	C	3: 135,371,897	E139D	possibly damaging	Het
Tjp1	A	T	7: 65,343,796		probably benign	Het
Tmcc3	A	T	10: 94,582,308	T344S	probably damaging	Het
Tnrc6b	T	A	15: 80,880,717	S807T	probably benign	Het
Trav7-6	A	T	14: 53,717,238	H95L	probably benign	Het
Trmu	T	A	15: 85,882,731	V47D	possibly damaging	Het
Uba6	C	A	5: 86,142,650		probably benign	Het
Unc79	A	G	12: 103,001,863	D116G	possibly damaging	Het
Vmn2r93	G	A	17: 18,305,387		probably null	Het
Zfp541	A	T	7: 16,079,084	H554L	possibly damaging	Het
Zfp618	A	G	4: 63,132,956	H658R	probably damaging	Het
Zmym1	A	T	4: 127,054,258	Y107N	probably damaging	Het

Other mutations in Ep300

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ep300	APN	15	81641418	missense	unknown
IGL01128:Ep300	APN	15	81630006	unclassified	probably benign
IGL01151:Ep300	APN	15	81623472	intron	probably benign
IGL01414:Ep300	APN	15	81627266	unclassified	probably benign
IGL01564:Ep300	APN	15	81632464	unclassified	probably benign
IGL01875:Ep300	APN	15	81640023	missense	unknown
IGL01945:Ep300	APN	15	81616109	unclassified	probably benign
IGL02022:Ep300	APN	15	81611437	unclassified	probably benign
IGL02115:Ep300	APN	15	81648818	missense	unknown
IGL02129:Ep300	APN	15	81586636	missense	unknown
IGL02145:Ep300	APN	15	81601166	missense	unknown
IGL02149:Ep300	APN	15	81628420	unclassified	probably benign
IGL02165:Ep300	APN	15	81641391	missense	probably benign	0.39
IGL02226:Ep300	APN	15	81613412	missense	unknown
IGL02610:Ep300	APN	15	81601522	missense	unknown
IGL02731:Ep300	APN	15	81648414	missense	unknown
IGL03239:Ep300	APN	15	81641388	missense	unknown
BB001:Ep300	UTSW	15	81649502	missense	unknown
BB011:Ep300	UTSW	15	81649502	missense	unknown
R0077:Ep300	UTSW	15	81641313	missense	unknown
R0145:Ep300	UTSW	15	81616127	critical splice donor site	probably null
R0244:Ep300	UTSW	15	81640128	missense	unknown
R0390:Ep300	UTSW	15	81640116	missense	unknown
R0534:Ep300	UTSW	15	81600896	splice site	probably benign
R0671:Ep300	UTSW	15	81616134	unclassified	probably benign
R0840:Ep300	UTSW	15	81644933	missense	unknown
R1166:Ep300	UTSW	15	81630064	unclassified	probably benign
R1737:Ep300	UTSW	15	81626347	missense	probably damaging	0.99
R1893:Ep300	UTSW	15	81631646	unclassified	probably benign
R2136:Ep300	UTSW	15	81640447	missense	unknown
R3427:Ep300	UTSW	15	81601279	missense	unknown
R3757:Ep300	UTSW	15	81648589	missense	unknown
R3892:Ep300	UTSW	15	81619997	unclassified	probably benign
R4554:Ep300	UTSW	15	81601430	missense	unknown
R4575:Ep300	UTSW	15	81649009	missense	unknown
R4575:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81611410	unclassified	probably benign
R5021:Ep300	UTSW	15	81640023	missense	unknown
R5366:Ep300	UTSW	15	81616100	missense	probably benign	0.24
R5372:Ep300	UTSW	15	81636830	missense	unknown
R5393:Ep300	UTSW	15	81631618	unclassified	probably benign
R5410:Ep300	UTSW	15	81648854	missense	unknown
R5571:Ep300	UTSW	15	81643217	intron	probably benign
R5701:Ep300	UTSW	15	81601495	missense	unknown
R5772:Ep300	UTSW	15	81639914	intron	probably benign
R5825:Ep300	UTSW	15	81611472	missense	probably benign	0.39
R5917:Ep300	UTSW	15	81628607	unclassified	probably benign
R5991:Ep300	UTSW	15	81648466	missense	unknown
R6019:Ep300	UTSW	15	81641382	missense	unknown
R6144:Ep300	UTSW	15	81601234	missense	unknown
R6291:Ep300	UTSW	15	81648507	missense	unknown
R6292:Ep300	UTSW	15	81616734	unclassified	probably benign
R6599:Ep300	UTSW	15	81586713	missense	unknown
R6804:Ep300	UTSW	15	81641311	nonsense	probably null
R6925:Ep300	UTSW	15	81649981	missense	probably benign	0.32
R7327:Ep300	UTSW	15	81627314	missense	unknown
R7378:Ep300	UTSW	15	81650545	missense	probably damaging	0.97
R7388:Ep300	UTSW	15	81648366	missense	unknown
R7419:Ep300	UTSW	15	81648514	missense	unknown
R7498:Ep300	UTSW	15	81639843	missense	unknown
R7584:Ep300	UTSW	15	81628426	missense	unknown
R7605:Ep300	UTSW	15	81621152	missense	unknown
R7619:Ep300	UTSW	15	81608198	missense	unknown
R7699:Ep300	UTSW	15	81586393	start gained	probably benign
R7763:Ep300	UTSW	15	81586583	start gained	probably benign
R7775:Ep300	UTSW	15	81586686	missense	unknown
R7778:Ep300	UTSW	15	81586686	missense	unknown
R7862:Ep300	UTSW	15	81650753	missense	probably damaging	1.00
R7924:Ep300	UTSW	15	81649502	missense	unknown
R8155:Ep300	UTSW	15	81621068	missense	unknown
R8259:Ep300	UTSW	15	81639017	missense	unknown
R8331:Ep300	UTSW	15	81601210	missense	unknown
R8554:Ep300	UTSW	15	81639027	missense	unknown
R9019:Ep300	UTSW	15	81648529	missense	unknown
R9128:Ep300	UTSW	15	81649745	missense	unknown
R9379:Ep300	UTSW	15	81648559	missense	unknown
R9380:Ep300	UTSW	15	81616044	missense	unknown
R9484:Ep300	UTSW	15	81636825	missense	unknown
R9659:Ep300	UTSW	15	81621072	missense	unknown
R9690:Ep300	UTSW	15	81636195	missense	unknown
R9721:Ep300	UTSW	15	81608315	missense	unknown
RF020:Ep300	UTSW	15	81586571	start gained	probably benign
Z1177:Ep300	UTSW	15	81630097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTCCACAACCAGGATTG -3'
(R):5'- TGAGCTTGGGGACTCATTGC -3'

Sequencing Primer
(F):5'- CCAGGATTGGGCCAAGTG -3'
(R):5'- GACTCATTGCTCCCATGGGTG -3'

Posted On

2020-07-28