Incidental Mutation 'R8276:Trmu'
ID637996
Institutional Source Beutler Lab
Gene Symbol Trmu
Ensembl Gene ENSMUSG00000022386
Gene NametRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Synonyms1600025P05Rik, Trmt1, 1110005N20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85879312-85897394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85882731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 47 (V47D)
Ref Sequence ENSEMBL: ENSMUSP00000023019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023019] [ENSMUST00000162491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023019
AA Change: V47D

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386
AA Change: V47D

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 133 7.7e-7 PFAM
Pfam:ThiI 3 79 7.7e-8 PFAM
Pfam:tRNA_Me_trans 5 383 3.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160733
AA Change: V67D
SMART Domains Protein: ENSMUSP00000125331
Gene: ENSMUSG00000022386
AA Change: V67D

DomainStartEndE-ValueType
Pfam:tRNA_Me_trans 4 34 8.2e-9 PFAM
Pfam:tRNA_Me_trans 41 104 5.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162339
SMART Domains Protein: ENSMUSP00000125266
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:tRNA_Me_trans 1 46 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162491
AA Change: V47D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125704
Gene: ENSMUSG00000022386
AA Change: V47D

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 88 1.1e-8 PFAM
Pfam:Asn_synthase 1 90 3e-7 PFAM
Pfam:ThiI 3 84 1.6e-10 PFAM
Pfam:tRNA_Me_trans 5 88 2.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous KO is embryonic lethal. Homozygous conditional KO in the liver affects mitochondrial function owing to impaired mt-tRNA modifications. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Trmu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trmu APN 15 85882831 missense probably benign 0.00
IGL02873:Trmu APN 15 85896832 splice site probably null
IGL03375:Trmu APN 15 85894937 missense possibly damaging 0.65
R0592:Trmu UTSW 15 85896826 unclassified probably benign
R0781:Trmu UTSW 15 85879403 nonsense probably null
R1120:Trmu UTSW 15 85890285 missense possibly damaging 0.75
R1165:Trmu UTSW 15 85892674 missense probably damaging 0.99
R1443:Trmu UTSW 15 85897101 splice site probably null
R1503:Trmu UTSW 15 85895019 missense possibly damaging 0.88
R4626:Trmu UTSW 15 85894985 missense possibly damaging 0.96
R4790:Trmu UTSW 15 85882805 missense probably damaging 1.00
R5134:Trmu UTSW 15 85896355 splice site probably null
R5399:Trmu UTSW 15 85896408 splice site probably null
R5639:Trmu UTSW 15 85882698 missense probably damaging 1.00
R6831:Trmu UTSW 15 85895006 missense probably benign
R8093:Trmu UTSW 15 85882720 missense probably benign 0.08
RF007:Trmu UTSW 15 85892569 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAGCCTTGGATTGCCATTC -3'
(R):5'- CAACTTCAGCACAGTCTTGGC -3'

Sequencing Primer
(F):5'- GCCTTGGATTGCCATTCAAAATATAC -3'
(R):5'- TGGAGAAGCACTGACTGTTCC -3'
Posted On2020-07-28