Incidental Mutation 'R8276:Vmn2r93'
ID637997
Institutional Source Beutler Lab
Gene Symbol Vmn2r93
Ensembl Gene ENSMUSG00000079698
Gene Namevomeronasal 2, receptor 93
SynonymsEG627132
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18298099-18331914 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 18305387 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079206]
Predicted Effect probably null
Transcript: ENSMUST00000079206
SMART Domains Protein: ENSMUSP00000078200
Gene: ENSMUSG00000079698

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 453 5.9e-40 PFAM
Pfam:NCD3G 509 562 2.6e-21 PFAM
Pfam:7tm_3 594 830 1.5e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Vmn2r93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Vmn2r93 APN 17 18326242 missense probably damaging 1.00
IGL01326:Vmn2r93 APN 17 18316644 missense possibly damaging 0.92
IGL01328:Vmn2r93 APN 17 18325557 missense probably benign 0.00
IGL01360:Vmn2r93 APN 17 18305248 missense possibly damaging 0.71
IGL01382:Vmn2r93 APN 17 18313316 nonsense probably null
IGL01463:Vmn2r93 APN 17 18304888 missense probably damaging 1.00
IGL02057:Vmn2r93 APN 17 18325770 missense probably damaging 1.00
IGL02257:Vmn2r93 APN 17 18325508 unclassified probably benign
IGL02686:Vmn2r93 APN 17 18313264 missense possibly damaging 0.89
IGL02720:Vmn2r93 APN 17 18305034 missense probably damaging 1.00
IGL03328:Vmn2r93 APN 17 18304958 missense probably damaging 1.00
PIT4576001:Vmn2r93 UTSW 17 18313211 missense probably benign
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0488:Vmn2r93 UTSW 17 18326049 missense probably damaging 1.00
R0667:Vmn2r93 UTSW 17 18326241 missense probably damaging 1.00
R0668:Vmn2r93 UTSW 17 18298405 missense probably benign 0.00
R0850:Vmn2r93 UTSW 17 18305017 missense possibly damaging 0.93
R0924:Vmn2r93 UTSW 17 18304181 missense probably benign
R0947:Vmn2r93 UTSW 17 18304081 missense probably benign 0.06
R1124:Vmn2r93 UTSW 17 18298448 missense probably benign 0.00
R1584:Vmn2r93 UTSW 17 18305151 missense possibly damaging 0.84
R1943:Vmn2r93 UTSW 17 18325801 missense probably benign 0.04
R2012:Vmn2r93 UTSW 17 18316578 missense probably benign 0.01
R2018:Vmn2r93 UTSW 17 18326062 missense probably damaging 1.00
R2196:Vmn2r93 UTSW 17 18305166 missense probably damaging 1.00
R2373:Vmn2r93 UTSW 17 18298403 missense probably benign
R2864:Vmn2r93 UTSW 17 18326061 missense probably damaging 1.00
R4276:Vmn2r93 UTSW 17 18304830 missense possibly damaging 0.47
R4446:Vmn2r93 UTSW 17 18304050 missense possibly damaging 0.93
R4537:Vmn2r93 UTSW 17 18304932 missense possibly damaging 0.86
R4674:Vmn2r93 UTSW 17 18304993 missense probably benign 0.34
R4726:Vmn2r93 UTSW 17 18316698 missense probably damaging 1.00
R4936:Vmn2r93 UTSW 17 18304065 missense possibly damaging 0.95
R4984:Vmn2r93 UTSW 17 18313127 splice site probably null
R5111:Vmn2r93 UTSW 17 18326064 missense probably damaging 0.99
R5749:Vmn2r93 UTSW 17 18298284 missense probably benign 0.06
R5918:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R5921:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R6091:Vmn2r93 UTSW 17 18325696 missense probably benign 0.06
R6283:Vmn2r93 UTSW 17 18304104 missense probably benign 0.02
R6680:Vmn2r93 UTSW 17 18316658 nonsense probably null
R6876:Vmn2r93 UTSW 17 18305188 missense probably benign 0.00
R6963:Vmn2r93 UTSW 17 18316587 missense probably damaging 1.00
R6996:Vmn2r93 UTSW 17 18304641 missense probably damaging 1.00
R7027:Vmn2r93 UTSW 17 18313286 missense probably benign 0.01
R7034:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7036:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7246:Vmn2r93 UTSW 17 18325750 missense possibly damaging 0.89
R7258:Vmn2r93 UTSW 17 18305141 missense probably benign 0.32
R7323:Vmn2r93 UTSW 17 18313235 nonsense probably null
R7325:Vmn2r93 UTSW 17 18303987 missense probably benign 0.01
R7390:Vmn2r93 UTSW 17 18305067 missense probably damaging 1.00
R7427:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7428:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7448:Vmn2r93 UTSW 17 18325986 missense probably benign 0.19
R7453:Vmn2r93 UTSW 17 18313318 missense probably benign 0.10
R7562:Vmn2r93 UTSW 17 18298469 missense probably benign 0.01
R7662:Vmn2r93 UTSW 17 18305369 missense probably benign 0.00
R7682:Vmn2r93 UTSW 17 18305321 missense probably benign 0.03
R7704:Vmn2r93 UTSW 17 18316648 missense probably benign 0.01
R7772:Vmn2r93 UTSW 17 18313220 missense probably damaging 0.99
R7957:Vmn2r93 UTSW 17 18325692 nonsense probably null
R8290:Vmn2r93 UTSW 17 18304029 missense probably damaging 1.00
R8362:Vmn2r93 UTSW 17 18326091 missense probably benign 0.02
R8376:Vmn2r93 UTSW 17 18304968 missense probably damaging 1.00
Z1088:Vmn2r93 UTSW 17 18326403 missense probably damaging 1.00
Z1177:Vmn2r93 UTSW 17 18305338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCACCATTACAGGGAGAATTCTG -3'
(R):5'- GCACACCAATTTACAACATCATGTG -3'

Sequencing Primer
(F):5'- TGTCAAACTAATGCTTCTTTGGATG -3'
(R):5'- CATCATGTGCTTGAAACTATCTTGAC -3'
Posted On2020-07-28