Incidental Mutation 'R8276:Amdhd2'
ID637998
Institutional Source Beutler Lab
Gene Symbol Amdhd2
Ensembl Gene ENSMUSG00000036820
Gene Nameamidohydrolase domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24155833-24163766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 24163600 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 22 (R22P)
Ref Sequence ENSEMBL: ENSMUSP00000036141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024932] [ENSMUST00000040735] [ENSMUST00000098862] [ENSMUST00000129523] [ENSMUST00000148541] [ENSMUST00000150647] [ENSMUST00000202853]
Predicted Effect probably benign
Transcript: ENSMUST00000024932
SMART Domains Protein: ENSMUSP00000024932
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 14 79 5.6e-17 PFAM
Pfam:ATP-synt_C 90 155 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040735
AA Change: R22P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036141
Gene: ENSMUSG00000036820
AA Change: R22P

DomainStartEndE-ValueType
Pfam:Amidohydro_1 62 401 7.2e-18 PFAM
Pfam:Amidohydro_3 327 404 5.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098862
SMART Domains Protein: ENSMUSP00000111059
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 15 77 1.1e-14 PFAM
Pfam:ATP-synt_C 92 153 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129523
SMART Domains Protein: ENSMUSP00000120520
Gene: ENSMUSG00000036820

DomainStartEndE-ValueType
Pfam:Amidohydro_5 1 71 1.5e-7 PFAM
Pfam:Amidohydro_4 22 176 2.5e-9 PFAM
Pfam:Amidohydro_1 27 134 2.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148541
SMART Domains Protein: ENSMUSP00000121464
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 14 79 5.2e-17 PFAM
Pfam:ATP-synt_C 90 150 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150647
SMART Domains Protein: ENSMUSP00000122843
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 32 85 5.1e-15 PFAM
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202853
SMART Domains Protein: ENSMUSP00000144462
Gene: ENSMUSG00000107169

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
Blast:TLDc 283 321 4e-13 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Amdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Amdhd2 APN 17 24163600 missense probably benign 0.38
IGL01868:Amdhd2 APN 17 24157530 missense probably damaging 1.00
IGL02889:Amdhd2 APN 17 24157787 missense probably damaging 1.00
IGL03127:Amdhd2 APN 17 24157738 critical splice donor site probably null
R0619:Amdhd2 UTSW 17 24156588 missense possibly damaging 0.65
R0759:Amdhd2 UTSW 17 24161613 missense probably benign 0.02
R0970:Amdhd2 UTSW 17 24156570 critical splice donor site probably null
R1657:Amdhd2 UTSW 17 24156055 missense probably damaging 1.00
R1929:Amdhd2 UTSW 17 24157886 unclassified probably null
R2080:Amdhd2 UTSW 17 24156604 missense probably benign 0.00
R2127:Amdhd2 UTSW 17 24158308 critical splice donor site probably null
R2871:Amdhd2 UTSW 17 24157855 unclassified probably benign
R4419:Amdhd2 UTSW 17 24158678 missense probably benign 0.31
R5681:Amdhd2 UTSW 17 24156040 missense probably damaging 1.00
R6315:Amdhd2 UTSW 17 24158356 missense probably benign 0.00
R6413:Amdhd2 UTSW 17 24158316 missense probably damaging 1.00
R7402:Amdhd2 UTSW 17 24161683 missense
Predicted Primers PCR Primer
(F):5'- TAGGCACTTGGATCACCACC -3'
(R):5'- CAGCTGAGAGTCACGTGATG -3'

Sequencing Primer
(F):5'- TGGAACCAAACCCTAGTTCTATCTCG -3'
(R):5'- TGAGAGTCACGTGATGCGACC -3'
Posted On2020-07-28