Incidental Mutation 'R8276:Slc9a3r2'
ID637999
Institutional Source Beutler Lab
Gene Symbol Slc9a3r2
Ensembl Gene ENSMUSG00000002504
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2
SynonymsSip1, 0610011L07Rik, Sryip1, Nherf2, Octs2, Tka-1, Sip-1, E3karp, 2010007A20Rik, 1200011K07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8276 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24639282-24650305 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 24642260 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 175 (Y175*)
Ref Sequence ENSEMBL: ENSMUSP00000002572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002572] [ENSMUST00000019684] [ENSMUST00000047611]
Predicted Effect probably null
Transcript: ENSMUST00000002572
AA Change: Y175*
SMART Domains Protein: ENSMUSP00000002572
Gene: ENSMUSG00000002504
AA Change: Y175*

DomainStartEndE-ValueType
PDZ 19 91 6.31e-21 SMART
PDZ 159 231 8.79e-20 SMART
Pfam:EBP50_C 232 284 5.1e-13 PFAM
Pfam:EBP50_C 261 337 2.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019684
AA Change: Y64*
SMART Domains Protein: ENSMUSP00000019684
Gene: ENSMUSG00000002504
AA Change: Y64*

DomainStartEndE-ValueType
PDZ 48 120 8.79e-20 SMART
Pfam:EBP50_C-term 186 226 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047611
SMART Domains Protein: ENSMUSP00000047413
Gene: ENSMUSG00000041429

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 24 37 N/A INTRINSIC
low complexity region 55 68 N/A INTRINSIC
ENDO3c 126 276 1.06e-58 SMART
FES 277 297 4.82e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal and display normal cAMP- and cGMP-activated CFTR transepithelial chloride transport and bicarbonate secretion in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Heatr5b G A 17: 78,791,539 R1311* probably null Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Slc9a3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02676:Slc9a3r2 APN 17 24641956 missense probably damaging 1.00
R1843:Slc9a3r2 UTSW 17 24641719 missense possibly damaging 0.75
R2199:Slc9a3r2 UTSW 17 24640596 missense probably null 0.37
R2912:Slc9a3r2 UTSW 17 24642241 missense probably damaging 1.00
R4774:Slc9a3r2 UTSW 17 24644899 start codon destroyed probably null 0.01
R5352:Slc9a3r2 UTSW 17 24642255 missense probably damaging 1.00
R5356:Slc9a3r2 UTSW 17 24641971 missense probably damaging 1.00
R5562:Slc9a3r2 UTSW 17 24641824 missense probably benign 0.06
R5841:Slc9a3r2 UTSW 17 24644877 missense probably benign
R7231:Slc9a3r2 UTSW 17 24650104 missense probably damaging 1.00
R7338:Slc9a3r2 UTSW 17 24650208 start gained probably benign
R7539:Slc9a3r2 UTSW 17 24641899 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATTCATCGAAGCCACCAGC -3'
(R):5'- ATGAAACCTGGGATTGGTTCC -3'

Sequencing Primer
(F):5'- GAAGCAAGAAGAGTGCCAGCTC -3'
(R):5'- AAACCTGGGATTGGTTCCTTAGAGC -3'
Posted On2020-07-28