Incidental Mutation 'R8276:Heatr5b'
ID 638000
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene Name HEAT repeat containing 5B
Synonyms 2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R8276 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78752906-78835381 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 78791539 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1311 (R1311*)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
AlphaFold Q8C547
Predicted Effect probably null
Transcript: ENSMUST00000097281
AA Change: R1311*
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: R1311*

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,928 R27W probably damaging Het
9430020K01Rik T A 18: 4,674,318 S693R probably damaging Het
Acbd5 A G 2: 23,069,551 D39G probably benign Het
Amdhd2 C G 17: 24,163,600 R22P probably damaging Het
Ankmy1 T C 1: 92,886,809 I325M probably benign Het
Cyld A G 8: 88,734,928 I664M probably benign Het
Dnajc10 T C 2: 80,349,270 M716T probably benign Het
Dock10 T A 1: 80,528,281 T1743S probably benign Het
Dopey1 T C 9: 86,517,039 S947P probably benign Het
Ep300 C G 15: 81,650,028 N2095K possibly damaging Het
Evi2a T A 11: 79,527,490 N98I probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Far2 G T 6: 148,173,901 V420L probably benign Het
Gng5 A G 3: 146,500,503 probably benign Het
Hhipl2 A T 1: 183,436,419 K478M possibly damaging Het
Hs3st1 A T 5: 39,614,803 Y166N probably damaging Het
Kcnmb3 A G 3: 32,482,423 L52P probably damaging Het
Mib1 T C 18: 10,751,880 I254T possibly damaging Het
Myo18b T C 5: 112,795,407 K1644R possibly damaging Het
Nlrp2 G A 7: 5,317,495 T881M probably benign Het
Olfr651 A T 7: 104,553,315 Y132F probably damaging Het
Olfr748 T A 14: 50,710,830 S167T probably benign Het
Pkd1l3 A C 8: 109,670,721 *2152C probably null Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ptpru C T 4: 131,779,173 G1026D probably damaging Het
Rbm46 A G 3: 82,864,588 V240A probably damaging Het
Rrm1 G A 7: 102,460,852 probably null Het
Ryr3 T C 2: 112,640,617 D4637G probably damaging Het
Serpina1e G T 12: 103,947,169 T364K probably damaging Het
Shroom3 A T 5: 92,940,480 Q363L probably damaging Het
Slc9a3r2 G T 17: 24,642,260 Y175* probably null Het
Slc9b1 A C 3: 135,371,897 E139D possibly damaging Het
Tjp1 A T 7: 65,343,796 probably benign Het
Tmcc3 A T 10: 94,582,308 T344S probably damaging Het
Tnrc6b T A 15: 80,880,717 S807T probably benign Het
Trav7-6 A T 14: 53,717,238 H95L probably benign Het
Trmu T A 15: 85,882,731 V47D possibly damaging Het
Uba6 C A 5: 86,142,650 probably benign Het
Unc79 A G 12: 103,001,863 D116G possibly damaging Het
Vimp G A 7: 66,079,804 probably benign Het
Vmn2r93 G A 17: 18,305,387 probably null Het
Zfp541 A T 7: 16,079,084 H554L possibly damaging Het
Zfp618 A G 4: 63,132,956 H658R probably damaging Het
Zmym1 A T 4: 127,054,258 Y107N probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R5470_heatr5b_501 UTSW 17 78821579 splice site probably null
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
R7922:Heatr5b UTSW 17 78760559 missense probably benign 0.01
R8184:Heatr5b UTSW 17 78814233 missense probably benign 0.03
R8222:Heatr5b UTSW 17 78801701 missense possibly damaging 0.95
R8324:Heatr5b UTSW 17 78755364 missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 78829624 missense probably damaging 0.97
R8432:Heatr5b UTSW 17 78803501 missense probably damaging 0.99
R8672:Heatr5b UTSW 17 78762203 missense probably damaging 1.00
R8781:Heatr5b UTSW 17 78795309 missense probably benign 0.19
R8794:Heatr5b UTSW 17 78815586 missense probably benign 0.00
R8808:Heatr5b UTSW 17 78765405 missense possibly damaging 0.92
R8850:Heatr5b UTSW 17 78801759 missense probably benign 0.02
R8893:Heatr5b UTSW 17 78761995 splice site probably benign
R9010:Heatr5b UTSW 17 78773710 missense probably damaging 1.00
R9041:Heatr5b UTSW 17 78796432 missense probably benign 0.12
R9150:Heatr5b UTSW 17 78796019 missense probably benign
R9253:Heatr5b UTSW 17 78827994 missense probably benign 0.13
R9318:Heatr5b UTSW 17 78765402 missense probably benign 0.07
R9448:Heatr5b UTSW 17 78760586 missense probably benign 0.26
R9489:Heatr5b UTSW 17 78753250 nonsense probably null
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTTGAGCGCCACATGAAGAGAC -3'
(R):5'- GCTGCACTGAGACACTTGAG -3'

Sequencing Primer
(F):5'- GAAGAGACCATATTCCCTCCTTTAG -3'
(R):5'- TCTGGGTGAACTTTCCCT -3'
Posted On 2020-07-28