Incidental Mutation 'R8277:Per2'
ID638003
Institutional Source Beutler Lab
Gene Symbol Per2
Ensembl Gene ENSMUSG00000055866
Gene Nameperiod circadian clock 2
SynonymsmPer2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R8277 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location91415982-91459324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91420552 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1109 (D1109E)
Ref Sequence ENSEMBL: ENSMUSP00000066620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069620]
Predicted Effect probably benign
Transcript: ENSMUST00000069620
AA Change: D1109E

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: D1109E

DomainStartEndE-ValueType
PAS 179 246 3.23e1 SMART
PAS 319 385 5.75e-2 SMART
PAC 393 436 1.6e0 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 821 834 N/A INTRINSIC
low complexity region 996 1014 N/A INTRINSIC
Pfam:Period_C 1040 1234 2.7e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C A 19: 57,215,919 L13F probably benign Het
Apoe C T 7: 19,698,378 probably benign Het
Arap2 A G 5: 62,613,992 probably null Het
Aspm T C 1: 139,455,010 S27P probably damaging Het
Atcay C A 10: 81,214,812 D90Y probably damaging Het
Cd46 A T 1: 195,064,722 D327E probably damaging Het
Cfh A G 1: 140,101,609 W1001R probably damaging Het
Chrm2 G A 6: 36,523,276 V23M probably benign Het
Col1a2 G A 6: 4,516,410 G175R probably null Het
Ddx52 T C 11: 83,955,114 S422P probably damaging Het
Gucy2d T A 7: 98,443,475 W20R probably benign Het
Hao2 A G 3: 98,880,384 I243T probably damaging Het
Hmcn2 A C 2: 31,369,177 T1010P probably benign Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Kat2b T A 17: 53,641,253 D350E probably benign Het
Lingo4 A G 3: 94,402,624 S290G possibly damaging Het
Mmrn1 A G 6: 60,977,236 T834A probably benign Het
Mro A T 18: 73,864,061 probably benign Het
Mrps26 T A 2: 130,564,427 L160Q probably damaging Het
Myh8 T C 11: 67,292,909 I788T probably benign Het
Nab2 G A 10: 127,665,299 probably benign Het
Nr2c2ap C T 8: 70,132,481 Q67* probably null Het
Olfr404-ps1 C T 11: 74,240,016 L151F probably benign Het
Pask C T 1: 93,325,363 probably null Het
Pcnx2 A T 8: 125,866,016 S736R probably damaging Het
Plxna1 G A 6: 89,357,180 H156Y probably damaging Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rbpms2 T A 9: 65,649,413 F45Y probably damaging Het
Rmdn3 T C 2: 119,146,424 D276G probably damaging Het
Sdccag3 G A 2: 26,384,766 A373V probably damaging Het
Sept2 T A 1: 93,499,308 I171K probably benign Het
Serpinb3a C A 1: 107,046,240 G314C probably damaging Het
Slc35f3 T A 8: 126,389,186 V284D possibly damaging Het
Snapc4 A G 2: 26,365,710 V934A probably benign Het
Tctn1 A G 5: 122,264,368 M1T probably null Het
Tgoln1 G A 6: 72,616,855 probably benign Het
Unc5c G A 3: 141,768,612 probably null Het
Vmn2r11 A T 5: 109,054,967 F81L probably benign Het
Vmn2r15 A T 5: 109,293,104 V296E probably benign Het
Vmn2r15 C T 5: 109,293,444 D183N probably damaging Het
Wdr34 A G 2: 30,033,874 V213A probably benign Het
Zfp763 T C 17: 33,033,320 probably benign Het
Other mutations in Per2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Per2 APN 1 91448833 missense probably damaging 0.98
IGL01350:Per2 APN 1 91430861 missense probably damaging 1.00
IGL01865:Per2 APN 1 91421517 missense probably benign 0.10
IGL01974:Per2 APN 1 91423718 missense probably benign 0.02
IGL02118:Per2 APN 1 91424309 missense probably damaging 0.99
IGL02271:Per2 APN 1 91445610 missense probably damaging 1.00
IGL02533:Per2 APN 1 91431002 missense possibly damaging 0.92
IGL02707:Per2 APN 1 91450728 missense possibly damaging 0.94
IGL02972:Per2 APN 1 91423981 missense possibly damaging 0.50
IGL03118:Per2 APN 1 91444619 nonsense probably null
IGL03125:Per2 APN 1 91450611 missense probably benign 0.00
IGL03375:Per2 APN 1 91424228 missense possibly damaging 0.76
IGL03388:Per2 APN 1 91444789 splice site probably benign
Kortiku UTSW 1 91423829 missense probably damaging 1.00
obst UTSW 1 91445539 missense probably benign 0.00
rhythm UTSW 1 91429382 critical splice donor site probably null
ANU23:Per2 UTSW 1 91448833 missense probably damaging 0.98
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0542:Per2 UTSW 1 91438332 critical splice donor site probably null
R0764:Per2 UTSW 1 91429420 missense probably damaging 1.00
R1370:Per2 UTSW 1 91445557 missense possibly damaging 0.94
R1655:Per2 UTSW 1 91448768 missense probably damaging 1.00
R1688:Per2 UTSW 1 91423829 missense probably damaging 1.00
R1997:Per2 UTSW 1 91440859 missense probably damaging 1.00
R2891:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2893:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2894:Per2 UTSW 1 91445603 missense probably damaging 1.00
R3109:Per2 UTSW 1 91445575 missense probably benign 0.02
R4125:Per2 UTSW 1 91429450 missense possibly damaging 0.71
R4997:Per2 UTSW 1 91450783 missense probably benign 0.02
R5110:Per2 UTSW 1 91429515 missense possibly damaging 0.57
R5478:Per2 UTSW 1 91432868 missense probably benign 0.09
R5590:Per2 UTSW 1 91427856 nonsense probably null
R5634:Per2 UTSW 1 91444707 missense probably benign 0.02
R5654:Per2 UTSW 1 91445501 splice site probably null
R5928:Per2 UTSW 1 91444651 missense probably damaging 1.00
R6241:Per2 UTSW 1 91421529 missense probably damaging 0.97
R6295:Per2 UTSW 1 91449872 missense unknown
R6345:Per2 UTSW 1 91448722 missense probably damaging 1.00
R6480:Per2 UTSW 1 91429382 critical splice donor site probably null
R6502:Per2 UTSW 1 91427763 missense probably benign 0.01
R6702:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6703:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6790:Per2 UTSW 1 91445539 missense probably benign 0.00
R7043:Per2 UTSW 1 91419408 missense probably benign
R7092:Per2 UTSW 1 91421431 missense probably damaging 1.00
R7430:Per2 UTSW 1 91423983 nonsense probably null
R7555:Per2 UTSW 1 91435135 missense probably damaging 1.00
R7860:Per2 UTSW 1 91444759 missense probably damaging 0.99
R8046:Per2 UTSW 1 91435703 missense possibly damaging 0.56
R8142:Per2 UTSW 1 91421547 missense possibly damaging 0.90
R8261:Per2 UTSW 1 91433448 missense possibly damaging 0.87
X0011:Per2 UTSW 1 91420589 missense possibly damaging 0.85
Z1176:Per2 UTSW 1 91421493 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAGGTATCCTGCCTGCATG -3'
(R):5'- GCACAGGCTGTTTCTACCCAAG -3'

Sequencing Primer
(F):5'- GTATCCTGCCTGCATGGATGAC -3'
(R):5'- GTTTCTACCCAAGGAACCCC -3'
Posted On2020-07-28