Incidental Mutation 'R8277:Serpinb3a'
ID638006
Institutional Source Beutler Lab
Gene Symbol Serpinb3a
Ensembl Gene ENSMUSG00000044594
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
SynonymsSqn5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8277 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107045587-107052303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107046240 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 314 (G314C)
Ref Sequence ENSEMBL: ENSMUSP00000027567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027567] [ENSMUST00000112717]
Predicted Effect probably damaging
Transcript: ENSMUST00000027567
AA Change: G314C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027567
Gene: ENSMUSG00000044594
AA Change: G314C

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112717
AA Change: G314C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108337
Gene: ENSMUSG00000044594
AA Change: G314C

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to allergen-induced airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C A 19: 57,215,919 L13F probably benign Het
Apoe C T 7: 19,698,378 probably benign Het
Arap2 A G 5: 62,613,992 probably null Het
Aspm T C 1: 139,455,010 S27P probably damaging Het
Atcay C A 10: 81,214,812 D90Y probably damaging Het
Cd46 A T 1: 195,064,722 D327E probably damaging Het
Cfh A G 1: 140,101,609 W1001R probably damaging Het
Chrm2 G A 6: 36,523,276 V23M probably benign Het
Col1a2 G A 6: 4,516,410 G175R probably null Het
Ddx52 T C 11: 83,955,114 S422P probably damaging Het
Gucy2d T A 7: 98,443,475 W20R probably benign Het
Hao2 A G 3: 98,880,384 I243T probably damaging Het
Hmcn2 A C 2: 31,369,177 T1010P probably benign Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Kat2b T A 17: 53,641,253 D350E probably benign Het
Lingo4 A G 3: 94,402,624 S290G possibly damaging Het
Mmrn1 A G 6: 60,977,236 T834A probably benign Het
Mro A T 18: 73,864,061 probably benign Het
Mrps26 T A 2: 130,564,427 L160Q probably damaging Het
Myh8 T C 11: 67,292,909 I788T probably benign Het
Nab2 G A 10: 127,665,299 probably benign Het
Nr2c2ap C T 8: 70,132,481 Q67* probably null Het
Olfr404-ps1 C T 11: 74,240,016 L151F probably benign Het
Pask C T 1: 93,325,363 probably null Het
Pcnx2 A T 8: 125,866,016 S736R probably damaging Het
Per2 G T 1: 91,420,552 D1109E probably benign Het
Plxna1 G A 6: 89,357,180 H156Y probably damaging Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rbpms2 T A 9: 65,649,413 F45Y probably damaging Het
Rmdn3 T C 2: 119,146,424 D276G probably damaging Het
Sdccag3 G A 2: 26,384,766 A373V probably damaging Het
Sept2 T A 1: 93,499,308 I171K probably benign Het
Slc35f3 T A 8: 126,389,186 V284D possibly damaging Het
Snapc4 A G 2: 26,365,710 V934A probably benign Het
Tctn1 A G 5: 122,264,368 M1T probably null Het
Tgoln1 G A 6: 72,616,855 probably benign Het
Unc5c G A 3: 141,768,612 probably null Het
Vmn2r11 A T 5: 109,054,967 F81L probably benign Het
Vmn2r15 A T 5: 109,293,104 V296E probably benign Het
Vmn2r15 C T 5: 109,293,444 D183N probably damaging Het
Wdr34 A G 2: 30,033,874 V213A probably benign Het
Zfp763 T C 17: 33,033,320 probably benign Het
Other mutations in Serpinb3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Serpinb3a APN 1 107051059 nonsense probably null
IGL01940:Serpinb3a APN 1 107046185 missense probably damaging 1.00
IGL02077:Serpinb3a APN 1 107046381 missense probably damaging 0.99
IGL02136:Serpinb3a APN 1 107046285 missense probably benign 0.15
IGL02214:Serpinb3a APN 1 107048488 critical splice donor site probably null
IGL02239:Serpinb3a APN 1 107051688 missense probably benign 0.05
IGL02508:Serpinb3a APN 1 107046072 missense probably damaging 1.00
IGL02533:Serpinb3a APN 1 107047162 missense probably benign 0.00
IGL02860:Serpinb3a APN 1 107049453 splice site probably benign
IGL03013:Serpinb3a APN 1 107046083 missense probably damaging 1.00
IGL03391:Serpinb3a APN 1 107046342 missense possibly damaging 0.81
R0321:Serpinb3a UTSW 1 107047482 nonsense probably null
R0416:Serpinb3a UTSW 1 107049386 missense probably benign 0.29
R0494:Serpinb3a UTSW 1 107047482 nonsense probably null
R0498:Serpinb3a UTSW 1 107047150 missense probably damaging 1.00
R1223:Serpinb3a UTSW 1 107047552 missense probably damaging 1.00
R1596:Serpinb3a UTSW 1 107047174 missense probably benign 0.12
R1655:Serpinb3a UTSW 1 107046212 missense probably damaging 1.00
R2156:Serpinb3a UTSW 1 107047472 critical splice donor site probably null
R2296:Serpinb3a UTSW 1 107047561 missense probably damaging 1.00
R4327:Serpinb3a UTSW 1 107051770 start codon destroyed probably damaging 1.00
R4612:Serpinb3a UTSW 1 107047607 missense probably damaging 0.99
R4830:Serpinb3a UTSW 1 107048586 missense probably benign 0.00
R5016:Serpinb3a UTSW 1 107046330 missense probably damaging 1.00
R5483:Serpinb3a UTSW 1 107047169 missense probably benign 0.16
R5619:Serpinb3a UTSW 1 107047108 missense probably damaging 1.00
R7227:Serpinb3a UTSW 1 107051629 missense probably damaging 1.00
R8526:Serpinb3a UTSW 1 107048774 splice site probably null
Z1177:Serpinb3a UTSW 1 107051008 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAGGGGAGGAGATTCTGCC -3'
(R):5'- CTTGAAGAACAACTCACTGCTG -3'

Sequencing Primer
(F):5'- TTCTGCCAAAGAAGAGGATGCTG -3'
(R):5'- CTCACTGCTGACAAGTTACTGGAG -3'
Posted On2020-07-28