Incidental Mutation 'R0719:Rock1'
ID 63802
Institutional Source Beutler Lab
Gene Symbol Rock1
Ensembl Gene ENSMUSG00000024290
Gene Name Rho-associated coiled-coil containing protein kinase 1
Synonyms 1110055K06Rik, Rock-I
MMRRC Submission 038901-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R0719 (G1)
Quality Score 86
Status Not validated
Chromosome 18
Chromosomal Location 10064401-10182045 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10099328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 691 (H691R)
Ref Sequence ENSEMBL: ENSMUSP00000069549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067947]
AlphaFold P70335
Predicted Effect probably damaging
Transcript: ENSMUST00000067947
AA Change: H691R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069549
Gene: ENSMUSG00000024290
AA Change: H691R

DomainStartEndE-ValueType
S_TKc 76 338 4.07e-97 SMART
S_TK_X 341 401 4.02e-9 SMART
low complexity region 408 419 N/A INTRINSIC
PDB:3O0Z|D 535 700 1e-101 PDB
low complexity region 715 731 N/A INTRINSIC
PDB:4L2W|B 832 914 7e-28 PDB
Pfam:Rho_Binding 948 1014 4.3e-26 PFAM
PH 1119 1319 1.19e-6 SMART
C1 1229 1283 2.64e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have open eyes at birth, omphalocele and most die soon after birth as a result of cannibalization by the mom. Survivors develop inflammation of the eyelid. Another homozygous mutant shows partial lethality around implantation and reduced cardiac fibrosis after pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Clk4 T A 11: 51,166,320 (GRCm39) Y67* probably null Het
Eif1 T A 11: 100,211,856 (GRCm39) I93K possibly damaging Het
Glmp G T 3: 88,233,452 (GRCm39) E136* probably null Het
Hgs T C 11: 120,362,431 (GRCm39) probably null Het
Iqcg T C 16: 32,861,215 (GRCm39) D167G probably benign Het
Or1ad6 T A 11: 50,860,761 (GRCm39) C305* probably null Het
Pik3c2g G A 6: 139,606,723 (GRCm39) E257K probably damaging Het
Ppp1r9b T A 11: 94,892,661 (GRCm39) probably null Het
Sgce T A 6: 4,689,753 (GRCm39) H360L probably damaging Het
Susd1 T A 4: 59,329,506 (GRCm39) N641I possibly damaging Het
Other mutations in Rock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Rock1 APN 18 10,080,502 (GRCm39) missense probably benign 0.44
IGL01535:Rock1 APN 18 10,132,119 (GRCm39) splice site probably benign
IGL01751:Rock1 APN 18 10,079,113 (GRCm39) critical splice donor site probably null
IGL01752:Rock1 APN 18 10,079,113 (GRCm39) critical splice donor site probably null
IGL02318:Rock1 APN 18 10,104,323 (GRCm39) splice site probably benign
IGL02420:Rock1 APN 18 10,070,619 (GRCm39) splice site probably null
IGL03030:Rock1 APN 18 10,070,215 (GRCm39) splice site probably benign
IGL03339:Rock1 APN 18 10,097,493 (GRCm39) missense probably benign 0.00
R0010:Rock1 UTSW 18 10,084,380 (GRCm39) missense probably damaging 0.99
R0010:Rock1 UTSW 18 10,084,380 (GRCm39) missense probably damaging 0.99
R0041:Rock1 UTSW 18 10,140,240 (GRCm39) missense probably damaging 1.00
R0041:Rock1 UTSW 18 10,140,240 (GRCm39) missense probably damaging 1.00
R0480:Rock1 UTSW 18 10,079,120 (GRCm39) missense possibly damaging 0.92
R0538:Rock1 UTSW 18 10,132,227 (GRCm39) missense possibly damaging 0.53
R1033:Rock1 UTSW 18 10,067,535 (GRCm39) missense probably benign 0.12
R1448:Rock1 UTSW 18 10,070,233 (GRCm39) missense probably damaging 1.00
R1465:Rock1 UTSW 18 10,072,863 (GRCm39) missense possibly damaging 0.80
R1465:Rock1 UTSW 18 10,072,863 (GRCm39) missense possibly damaging 0.80
R1470:Rock1 UTSW 18 10,136,091 (GRCm39) splice site probably null
R1470:Rock1 UTSW 18 10,136,091 (GRCm39) splice site probably null
R1694:Rock1 UTSW 18 10,136,094 (GRCm39) critical splice donor site probably null
R1862:Rock1 UTSW 18 10,079,207 (GRCm39) missense probably damaging 0.99
R1995:Rock1 UTSW 18 10,101,026 (GRCm39) nonsense probably null
R2177:Rock1 UTSW 18 10,070,263 (GRCm39) missense probably benign 0.18
R2892:Rock1 UTSW 18 10,072,863 (GRCm39) nonsense probably null
R3780:Rock1 UTSW 18 10,067,575 (GRCm39) missense probably benign 0.00
R3884:Rock1 UTSW 18 10,122,768 (GRCm39) missense probably damaging 1.00
R4352:Rock1 UTSW 18 10,079,237 (GRCm39) missense probably damaging 1.00
R4414:Rock1 UTSW 18 10,080,514 (GRCm39) missense probably damaging 1.00
R4646:Rock1 UTSW 18 10,112,391 (GRCm39) missense probably benign
R4694:Rock1 UTSW 18 10,136,152 (GRCm39) nonsense probably null
R4888:Rock1 UTSW 18 10,122,698 (GRCm39) missense probably benign 0.06
R5085:Rock1 UTSW 18 10,140,210 (GRCm39) missense probably damaging 1.00
R5884:Rock1 UTSW 18 10,099,361 (GRCm39) missense probably benign 0.03
R5927:Rock1 UTSW 18 10,116,792 (GRCm39) missense probably damaging 1.00
R6084:Rock1 UTSW 18 10,101,007 (GRCm39) missense probably benign 0.15
R6151:Rock1 UTSW 18 10,106,426 (GRCm39) missense possibly damaging 0.79
R6360:Rock1 UTSW 18 10,116,778 (GRCm39) missense possibly damaging 0.52
R6892:Rock1 UTSW 18 10,122,612 (GRCm39) missense probably benign 0.00
R7313:Rock1 UTSW 18 10,129,317 (GRCm39) missense possibly damaging 0.73
R7397:Rock1 UTSW 18 10,097,599 (GRCm39) missense possibly damaging 0.80
R7488:Rock1 UTSW 18 10,122,762 (GRCm39) missense probably damaging 1.00
R7515:Rock1 UTSW 18 10,067,631 (GRCm39) missense probably damaging 0.97
R7567:Rock1 UTSW 18 10,090,820 (GRCm39) missense probably benign 0.35
R7569:Rock1 UTSW 18 10,140,194 (GRCm39) missense probably damaging 1.00
R7639:Rock1 UTSW 18 10,140,244 (GRCm39) missense probably damaging 1.00
R7836:Rock1 UTSW 18 10,097,651 (GRCm39) splice site probably null
R7844:Rock1 UTSW 18 10,104,173 (GRCm39) missense probably damaging 0.99
R7943:Rock1 UTSW 18 10,112,357 (GRCm39) missense probably damaging 1.00
R7945:Rock1 UTSW 18 10,116,831 (GRCm39) missense probably damaging 1.00
R8421:Rock1 UTSW 18 10,072,863 (GRCm39) nonsense probably null
R8801:Rock1 UTSW 18 10,070,260 (GRCm39) missense probably damaging 1.00
R8819:Rock1 UTSW 18 10,070,626 (GRCm39) missense probably damaging 1.00
R9281:Rock1 UTSW 18 10,080,479 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGTCTACACTGAAATTGTGACTGGAAG -3'
(R):5'- GGAACACAAGGAACTCTGCATCAGC -3'

Sequencing Primer
(F):5'- cccaagccctatcctcaaaac -3'
(R):5'- GGAACTCTGCATCAGCTATTATG -3'
Posted On 2013-07-30