Mutagenetix > Incidental Mutations

Incidental Mutation 'R8277:Plxna1'

638027

Institutional Source

Beutler Lab

Gene Symbol

Plxna1

Ensembl Gene

ENSMUSG00000030084

Gene Name

plexin A1

Synonyms

NOV, Plxn1, PlexA1, 2600013D04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.869) question?

Stock #

R8277 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89316314-89362620 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 89357180 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 156 (H156Y)

Ref Sequence

ENSEMBL: ENSMUSP00000063066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]

PDB Structure

The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049845
AA Change: H156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: H156Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163139
AA Change: H156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: H156Y

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	C	A	19: 57,215,919	L13F	probably benign	Het
Apoe	C	T	7: 19,698,378		probably benign	Het
Arap2	A	G	5: 62,613,992		probably null	Het
Aspm	T	C	1: 139,455,010	S27P	probably damaging	Het
Atcay	C	A	10: 81,214,812	D90Y	probably damaging	Het
Cd46	A	T	1: 195,064,722	D327E	probably damaging	Het
Cfh	A	G	1: 140,101,609	W1001R	probably damaging	Het
Chrm2	G	A	6: 36,523,276	V23M	probably benign	Het
Col1a2	G	A	6: 4,516,410	G175R	probably null	Het
Ddx52	T	C	11: 83,955,114	S422P	probably damaging	Het
Gucy2d	T	A	7: 98,443,475	W20R	probably benign	Het
Hao2	A	G	3: 98,880,384	I243T	probably damaging	Het
Hmcn2	A	C	2: 31,369,177	T1010P	probably benign	Het
Iqcf1	T	C	9: 106,501,878	S29P	probably benign	Het
Kat2b	T	A	17: 53,641,253	D350E	probably benign	Het
Lingo4	A	G	3: 94,402,624	S290G	possibly damaging	Het
Mmrn1	A	G	6: 60,977,236	T834A	probably benign	Het
Mro	A	T	18: 73,864,061		probably benign	Het
Mrps26	T	A	2: 130,564,427	L160Q	probably damaging	Het
Myh8	T	C	11: 67,292,909	I788T	probably benign	Het
Nab2	G	A	10: 127,665,299		probably benign	Het
Nr2c2ap	C	T	8: 70,132,481	Q67*	probably null	Het
Olfr404-ps1	C	T	11: 74,240,016	L151F	probably benign	Het
Pask	C	T	1: 93,325,363		probably null	Het
Pcnx2	A	T	8: 125,866,016	S736R	probably damaging	Het
Per2	G	T	1: 91,420,552	D1109E	probably benign	Het
Polr2a	G	A	11: 69,748,056	R51C	probably damaging	Het
Rbpms2	T	A	9: 65,649,413	F45Y	probably damaging	Het
Rmdn3	T	C	2: 119,146,424	D276G	probably damaging	Het
Sdccag3	G	A	2: 26,384,766	A373V	probably damaging	Het
Sept2	T	A	1: 93,499,308	I171K	probably benign	Het
Serpinb3a	C	A	1: 107,046,240	G314C	probably damaging	Het
Slc35f3	T	A	8: 126,389,186	V284D	possibly damaging	Het
Snapc4	A	G	2: 26,365,710	V934A	probably benign	Het
Tctn1	A	G	5: 122,264,368	M1T	probably null	Het
Tgoln1	G	A	6: 72,616,855		probably benign	Het
Unc5c	G	A	3: 141,768,612		probably null	Het
Vmn2r11	A	T	5: 109,054,967	F81L	probably benign	Het
Vmn2r15	A	T	5: 109,293,104	V296E	probably benign	Het
Vmn2r15	C	T	5: 109,293,444	D183N	probably damaging	Het
Wdr34	A	G	2: 30,033,874	V213A	probably benign	Het
Zfp763	T	C	17: 33,033,320		probably benign	Het

Other mutations in Plxna1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Plxna1	APN	6	89320998	missense	probably damaging	1.00
IGL01358:Plxna1	APN	6	89322750	missense	probably damaging	1.00
IGL01475:Plxna1	APN	6	89354888	missense	possibly damaging	0.92
IGL01480:Plxna1	APN	6	89344096	missense	possibly damaging	0.70
IGL01585:Plxna1	APN	6	89329556	critical splice donor site	probably null
IGL01804:Plxna1	APN	6	89329646	missense	probably damaging	1.00
IGL01909:Plxna1	APN	6	89332084	critical splice donor site	probably null
IGL01989:Plxna1	APN	6	89329414	nonsense	probably null
IGL02015:Plxna1	APN	6	89342451	missense	probably damaging	1.00
IGL02023:Plxna1	APN	6	89357332	missense	possibly damaging	0.88
IGL02668:Plxna1	APN	6	89357269	nonsense	probably null
IGL02703:Plxna1	APN	6	89356943	missense	probably damaging	1.00
IGL02954:Plxna1	APN	6	89324667	missense	probably damaging	1.00
IGL03212:Plxna1	APN	6	89331903	missense	probably damaging	1.00
PIT4544001:Plxna1	UTSW	6	89357429	missense	probably benign	0.14
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0147:Plxna1	UTSW	6	89320710	missense	possibly damaging	0.95
R0149:Plxna1	UTSW	6	89320613	missense	probably null	0.95
R0166:Plxna1	UTSW	6	89333019	missense	probably damaging	1.00
R0200:Plxna1	UTSW	6	89323593	missense	probably damaging	1.00
R0415:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
R0841:Plxna1	UTSW	6	89332204	missense	probably damaging	1.00
R1018:Plxna1	UTSW	6	89342960	missense	probably damaging	1.00
R1240:Plxna1	UTSW	6	89321050	missense	probably damaging	1.00
R1355:Plxna1	UTSW	6	89320766	unclassified	probably benign
R1700:Plxna1	UTSW	6	89357008	missense	probably damaging	1.00
R1776:Plxna1	UTSW	6	89335464	missense	probably benign	0.00
R1957:Plxna1	UTSW	6	89331291	missense	probably damaging	1.00
R2314:Plxna1	UTSW	6	89324316	missense	probably damaging	1.00
R2968:Plxna1	UTSW	6	89342608	missense	probably damaging	1.00
R3118:Plxna1	UTSW	6	89356976	missense	possibly damaging	0.89
R3522:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R3619:Plxna1	UTSW	6	89357453	missense	probably damaging	0.97
R3766:Plxna1	UTSW	6	89334775	unclassified	probably benign
R3847:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3849:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3872:Plxna1	UTSW	6	89332692	nonsense	probably null
R4555:Plxna1	UTSW	6	89323328	missense	probably damaging	0.99
R4709:Plxna1	UTSW	6	89334751	missense	possibly damaging	0.72
R4726:Plxna1	UTSW	6	89322816	missense	probably damaging	1.00
R4739:Plxna1	UTSW	6	89332675	splice site	probably null
R5053:Plxna1	UTSW	6	89322460	missense	probably damaging	1.00
R5221:Plxna1	UTSW	6	89321016	missense	probably damaging	1.00
R5449:Plxna1	UTSW	6	89323608	missense	probably damaging	1.00
R5480:Plxna1	UTSW	6	89324634	missense	probably damaging	1.00
R5575:Plxna1	UTSW	6	89324541	missense	possibly damaging	0.83
R5743:Plxna1	UTSW	6	89356529	missense	probably damaging	1.00
R5744:Plxna1	UTSW	6	89334682	missense	possibly damaging	0.67
R5754:Plxna1	UTSW	6	89333105	missense	possibly damaging	0.96
R5868:Plxna1	UTSW	6	89322722	splice site	probably benign
R5988:Plxna1	UTSW	6	89357540	nonsense	probably null
R6190:Plxna1	UTSW	6	89356604	nonsense	probably null
R6425:Plxna1	UTSW	6	89334665	missense	probably benign	0.00
R6561:Plxna1	UTSW	6	89356978	missense	probably damaging	1.00
R6623:Plxna1	UTSW	6	89322771	missense	probably damaging	1.00
R6638:Plxna1	UTSW	6	89324400	missense	probably damaging	0.97
R6701:Plxna1	UTSW	6	89319448	missense	probably damaging	0.99
R6825:Plxna1	UTSW	6	89320615	missense	probably benign	0.01
R6911:Plxna1	UTSW	6	89320974	missense	probably damaging	1.00
R7073:Plxna1	UTSW	6	89357329	missense	probably damaging	1.00
R7177:Plxna1	UTSW	6	89323329	missense	possibly damaging	0.50
R7235:Plxna1	UTSW	6	89340591	missense	probably damaging	0.97
R7419:Plxna1	UTSW	6	89357602	missense	unknown
R7511:Plxna1	UTSW	6	89341907	missense	possibly damaging	0.71
R7543:Plxna1	UTSW	6	89322855	missense	probably damaging	1.00
R7665:Plxna1	UTSW	6	89324538	critical splice donor site	probably null
R7678:Plxna1	UTSW	6	89331900	missense	probably damaging	0.99
R7748:Plxna1	UTSW	6	89337352	critical splice acceptor site	probably null
R7748:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R7877:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
R8025:Plxna1	UTSW	6	89331272	missense	probably damaging	1.00
R8171:Plxna1	UTSW	6	89357120	missense	probably benign	0.20
S24628:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
V8831:Plxna1	UTSW	6	89357137	missense	probably damaging	0.99
Z1176:Plxna1	UTSW	6	89321052	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAAACATGTCAGCATCTTCC -3'
(R):5'- TGTGACAGGCCCTGTAGAAGAC -3'

Sequencing Primer
(F):5'- AAACATGTCAGCATCTTCCTCGTTG -3'
(R):5'- CCCTGTAGAAGACAATGAGAAATGC -3'

Posted On

2020-07-28