Incidental Mutation 'R8277:Plxna1'
ID638027
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Nameplexin A1
SynonymsNOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R8277 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location89316314-89362620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89357180 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 156 (H156Y)
Ref Sequence ENSEMBL: ENSMUSP00000063066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
PDB Structure
The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049845
AA Change: H156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: H156Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163139
AA Change: H156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: H156Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C A 19: 57,215,919 L13F probably benign Het
Apoe C T 7: 19,698,378 probably benign Het
Arap2 A G 5: 62,613,992 probably null Het
Aspm T C 1: 139,455,010 S27P probably damaging Het
Atcay C A 10: 81,214,812 D90Y probably damaging Het
Cd46 A T 1: 195,064,722 D327E probably damaging Het
Cfh A G 1: 140,101,609 W1001R probably damaging Het
Chrm2 G A 6: 36,523,276 V23M probably benign Het
Col1a2 G A 6: 4,516,410 G175R probably null Het
Ddx52 T C 11: 83,955,114 S422P probably damaging Het
Gucy2d T A 7: 98,443,475 W20R probably benign Het
Hao2 A G 3: 98,880,384 I243T probably damaging Het
Hmcn2 A C 2: 31,369,177 T1010P probably benign Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Kat2b T A 17: 53,641,253 D350E probably benign Het
Lingo4 A G 3: 94,402,624 S290G possibly damaging Het
Mmrn1 A G 6: 60,977,236 T834A probably benign Het
Mro A T 18: 73,864,061 probably benign Het
Mrps26 T A 2: 130,564,427 L160Q probably damaging Het
Myh8 T C 11: 67,292,909 I788T probably benign Het
Nab2 G A 10: 127,665,299 probably benign Het
Nr2c2ap C T 8: 70,132,481 Q67* probably null Het
Olfr404-ps1 C T 11: 74,240,016 L151F probably benign Het
Pask C T 1: 93,325,363 probably null Het
Pcnx2 A T 8: 125,866,016 S736R probably damaging Het
Per2 G T 1: 91,420,552 D1109E probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rbpms2 T A 9: 65,649,413 F45Y probably damaging Het
Rmdn3 T C 2: 119,146,424 D276G probably damaging Het
Sdccag3 G A 2: 26,384,766 A373V probably damaging Het
Sept2 T A 1: 93,499,308 I171K probably benign Het
Serpinb3a C A 1: 107,046,240 G314C probably damaging Het
Slc35f3 T A 8: 126,389,186 V284D possibly damaging Het
Snapc4 A G 2: 26,365,710 V934A probably benign Het
Tctn1 A G 5: 122,264,368 M1T probably null Het
Tgoln1 G A 6: 72,616,855 probably benign Het
Unc5c G A 3: 141,768,612 probably null Het
Vmn2r11 A T 5: 109,054,967 F81L probably benign Het
Vmn2r15 A T 5: 109,293,104 V296E probably benign Het
Vmn2r15 C T 5: 109,293,444 D183N probably damaging Het
Wdr34 A G 2: 30,033,874 V213A probably benign Het
Zfp763 T C 17: 33,033,320 probably benign Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89320998 missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89322750 missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89354888 missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89344096 missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89329556 critical splice donor site probably null
IGL01804:Plxna1 APN 6 89329646 missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89332084 critical splice donor site probably null
IGL01989:Plxna1 APN 6 89329414 nonsense probably null
IGL02015:Plxna1 APN 6 89342451 missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89357332 missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89357269 nonsense probably null
IGL02703:Plxna1 APN 6 89356943 missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89324667 missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89331903 missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89357429 missense probably benign 0.14
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89329739 missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89320710 missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89320613 missense probably null 0.95
R0166:Plxna1 UTSW 6 89333019 missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89323593 missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89357336 missense probably benign 0.12
R0841:Plxna1 UTSW 6 89332204 missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89342960 missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89321050 missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89320766 unclassified probably benign
R1700:Plxna1 UTSW 6 89357008 missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89335464 missense probably benign 0.00
R1957:Plxna1 UTSW 6 89331291 missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89324316 missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89342608 missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89356976 missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89357453 missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89334775 unclassified probably benign
R3847:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89356519 missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89332692 nonsense probably null
R4555:Plxna1 UTSW 6 89323328 missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89334751 missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89322816 missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89332675 splice site probably null
R5053:Plxna1 UTSW 6 89322460 missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89321016 missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89323608 missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89324634 missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89324541 missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89356529 missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89334682 missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89333105 missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89322722 splice site probably benign
R5988:Plxna1 UTSW 6 89357540 nonsense probably null
R6190:Plxna1 UTSW 6 89356604 nonsense probably null
R6425:Plxna1 UTSW 6 89334665 missense probably benign 0.00
R6561:Plxna1 UTSW 6 89356978 missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89322771 missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89324400 missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89319448 missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89320615 missense probably benign 0.01
R6911:Plxna1 UTSW 6 89320974 missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89357329 missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89323329 missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89340591 missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89357602 missense unknown
R7511:Plxna1 UTSW 6 89341907 missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89322855 missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89324538 critical splice donor site probably null
R7678:Plxna1 UTSW 6 89331900 missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89337352 critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89337353 critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89323259 missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89331272 missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89357120 missense probably benign 0.20
S24628:Plxna1 UTSW 6 89357336 missense probably benign 0.12
V8831:Plxna1 UTSW 6 89357137 missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89321052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAACATGTCAGCATCTTCC -3'
(R):5'- TGTGACAGGCCCTGTAGAAGAC -3'

Sequencing Primer
(F):5'- AAACATGTCAGCATCTTCCTCGTTG -3'
(R):5'- CCCTGTAGAAGACAATGAGAAATGC -3'
Posted On2020-07-28