Incidental Mutation 'R0724:Dyrk3'
ID63803
Institutional Source Beutler Lab
Gene Symbol Dyrk3
Ensembl Gene ENSMUSG00000016526
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Synonyms
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R0724 (G1)
Quality Score128
Status Validated
Chromosome1
Chromosomal Location131127455-131138340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131130140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 64 (T64A)
Ref Sequence ENSEMBL: ENSMUSP00000140050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016670] [ENSMUST00000189756]
Predicted Effect probably benign
Transcript: ENSMUST00000016670
AA Change: T99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016670
Gene: ENSMUSG00000016526
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
S_TKc 208 521 2.45e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189756
AA Change: T64A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140050
Gene: ENSMUSG00000016526
AA Change: T64A

DomainStartEndE-ValueType
PDB:4AZF|A 101 152 3e-18 PDB
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased erythropoiesis in response to chemically-induced anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Dyrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Dyrk3 APN 1 131136337 missense possibly damaging 0.71
IGL00910:Dyrk3 APN 1 131136336 missense possibly damaging 0.92
IGL02436:Dyrk3 APN 1 131128865 missense probably benign 0.00
IGL03057:Dyrk3 APN 1 131129078 missense probably benign 0.01
PIT4576001:Dyrk3 UTSW 1 131130181 missense probably damaging 0.98
R0116:Dyrk3 UTSW 1 131129839 missense probably damaging 1.00
R0361:Dyrk3 UTSW 1 131130032 missense probably benign 0.00
R0457:Dyrk3 UTSW 1 131136357 missense possibly damaging 0.94
R0529:Dyrk3 UTSW 1 131130121 missense probably benign 0.00
R1116:Dyrk3 UTSW 1 131129182 missense probably damaging 1.00
R2999:Dyrk3 UTSW 1 131129446 missense probably damaging 1.00
R3423:Dyrk3 UTSW 1 131129482 missense probably damaging 1.00
R4591:Dyrk3 UTSW 1 131130158 missense probably damaging 1.00
R5358:Dyrk3 UTSW 1 131129695 missense probably damaging 1.00
R5608:Dyrk3 UTSW 1 131128715 missense probably benign
R6767:Dyrk3 UTSW 1 131129590 missense probably damaging 0.99
R7072:Dyrk3 UTSW 1 131129728 missense probably damaging 1.00
R7744:Dyrk3 UTSW 1 131129806 missense probably damaging 1.00
R7775:Dyrk3 UTSW 1 131129627 missense possibly damaging 0.84
R7909:Dyrk3 UTSW 1 131129587 missense probably damaging 1.00
R7990:Dyrk3 UTSW 1 131129587 missense probably damaging 1.00
R8009:Dyrk3 UTSW 1 131136258 critical splice donor site probably null
Z1088:Dyrk3 UTSW 1 131129233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCGTCGTAGCCACCGTTATTG -3'
(R):5'- TCAGTCAGAGAGAAGGCCCTTTCG -3'

Sequencing Primer
(F):5'- CCACAAAGTAGATTTCTGGGTAGC -3'
(R):5'- AAGGCCCTTTCGCCTTC -3'
Posted On2013-07-30