Incidental Mutation 'R8277:Zfp763'
ID638041
Institutional Source Beutler Lab
Gene Symbol Zfp763
Ensembl Gene ENSMUSG00000067430
Gene Namezinc finger protein 763
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8277 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33016863-33033402 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 33033320 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087654]
Predicted Effect probably benign
Transcript: ENSMUST00000087654
SMART Domains Protein: ENSMUSP00000084936
Gene: ENSMUSG00000067430

DomainStartEndE-ValueType
KRAB 10 60 7.47e-14 SMART
ZnF_C2H2 223 245 2.53e-2 SMART
ZnF_C2H2 251 273 4.54e-4 SMART
ZnF_C2H2 279 301 1.69e-3 SMART
ZnF_C2H2 307 329 5.72e-1 SMART
ZnF_C2H2 335 357 1.64e-1 SMART
ZnF_C2H2 363 385 1.56e-2 SMART
ZnF_C2H2 391 413 1.82e-3 SMART
ZnF_C2H2 419 441 1.64e-1 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
ZnF_C2H2 475 497 2.02e-1 SMART
ZnF_C2H2 503 525 7.15e-2 SMART
ZnF_C2H2 531 553 1.79e-2 SMART
ZnF_C2H2 559 581 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C A 19: 57,215,919 L13F probably benign Het
Apoe C T 7: 19,698,378 probably benign Het
Arap2 A G 5: 62,613,992 probably null Het
Aspm T C 1: 139,455,010 S27P probably damaging Het
Atcay C A 10: 81,214,812 D90Y probably damaging Het
Cd46 A T 1: 195,064,722 D327E probably damaging Het
Cfh A G 1: 140,101,609 W1001R probably damaging Het
Chrm2 G A 6: 36,523,276 V23M probably benign Het
Col1a2 G A 6: 4,516,410 G175R probably null Het
Ddx52 T C 11: 83,955,114 S422P probably damaging Het
Gucy2d T A 7: 98,443,475 W20R probably benign Het
Hao2 A G 3: 98,880,384 I243T probably damaging Het
Hmcn2 A C 2: 31,369,177 T1010P probably benign Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Kat2b T A 17: 53,641,253 D350E probably benign Het
Lingo4 A G 3: 94,402,624 S290G possibly damaging Het
Mmrn1 A G 6: 60,977,236 T834A probably benign Het
Mro A T 18: 73,864,061 probably benign Het
Mrps26 T A 2: 130,564,427 L160Q probably damaging Het
Myh8 T C 11: 67,292,909 I788T probably benign Het
Nab2 G A 10: 127,665,299 probably benign Het
Nr2c2ap C T 8: 70,132,481 Q67* probably null Het
Olfr404-ps1 C T 11: 74,240,016 L151F probably benign Het
Pask C T 1: 93,325,363 probably null Het
Pcnx2 A T 8: 125,866,016 S736R probably damaging Het
Per2 G T 1: 91,420,552 D1109E probably benign Het
Plxna1 G A 6: 89,357,180 H156Y probably damaging Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rbpms2 T A 9: 65,649,413 F45Y probably damaging Het
Rmdn3 T C 2: 119,146,424 D276G probably damaging Het
Sdccag3 G A 2: 26,384,766 A373V probably damaging Het
Sept2 T A 1: 93,499,308 I171K probably benign Het
Serpinb3a C A 1: 107,046,240 G314C probably damaging Het
Slc35f3 T A 8: 126,389,186 V284D possibly damaging Het
Snapc4 A G 2: 26,365,710 V934A probably benign Het
Tctn1 A G 5: 122,264,368 M1T probably null Het
Tgoln1 G A 6: 72,616,855 probably benign Het
Unc5c G A 3: 141,768,612 probably null Het
Vmn2r11 A T 5: 109,054,967 F81L probably benign Het
Vmn2r15 A T 5: 109,293,104 V296E probably benign Het
Vmn2r15 C T 5: 109,293,444 D183N probably damaging Het
Wdr34 A G 2: 30,033,874 V213A probably benign Het
Other mutations in Zfp763
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Zfp763 APN 17 33019934 missense probably benign 0.41
IGL03291:Zfp763 APN 17 33019886 missense probably damaging 0.96
R0346:Zfp763 UTSW 17 33019747 missense probably benign 0.26
R0675:Zfp763 UTSW 17 33019800 missense possibly damaging 0.92
R0683:Zfp763 UTSW 17 33018918 missense probably damaging 1.00
R1494:Zfp763 UTSW 17 33021503 missense probably damaging 0.99
R1521:Zfp763 UTSW 17 33033302 start codon destroyed probably benign 0.03
R1607:Zfp763 UTSW 17 33019907 missense probably benign 0.08
R1627:Zfp763 UTSW 17 33021784 missense probably damaging 1.00
R1714:Zfp763 UTSW 17 33019617 missense probably damaging 0.99
R1993:Zfp763 UTSW 17 33018439 missense probably damaging 1.00
R2109:Zfp763 UTSW 17 33019778 missense probably benign
R4420:Zfp763 UTSW 17 33018481 missense probably benign 0.43
R4612:Zfp763 UTSW 17 33018948 missense probably benign 0.05
R5114:Zfp763 UTSW 17 33018975 missense probably damaging 0.99
R5426:Zfp763 UTSW 17 33019595 missense probably benign
R5503:Zfp763 UTSW 17 33019533 missense possibly damaging 0.95
R5534:Zfp763 UTSW 17 33021794 missense probably damaging 0.97
R6133:Zfp763 UTSW 17 33018701 missense possibly damaging 0.75
R7141:Zfp763 UTSW 17 33018795 missense probably damaging 0.97
R7365:Zfp763 UTSW 17 33033378 start gained probably benign
R7430:Zfp763 UTSW 17 33019532 missense possibly damaging 0.68
R7552:Zfp763 UTSW 17 33018651 missense probably benign
R8446:Zfp763 UTSW 17 33019499 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCGCACAATTCCAGTGTC -3'
(R):5'- ATTCTAACTGCACTGGGAAAGAG -3'

Sequencing Primer
(F):5'- AATTCCAGTGTCCCGCTCCAAG -3'
(R):5'- TTAAGGCATTTAAGCTCAAGGC -3'
Posted On2020-07-28