Incidental Mutation 'R8278:Pgap1'
ID638046
Institutional Source Beutler Lab
Gene Symbol Pgap1
Ensembl Gene ENSMUSG00000073678
Gene Namepost-GPI attachment to proteins 1
SynonymsPGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location54472994-54557684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54490271 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 763 (V763I)
Ref Sequence ENSEMBL: ENSMUSP00000095346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097739]
Predicted Effect probably benign
Transcript: ENSMUST00000097739
AA Change: V763I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: V763I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PGAP1 82 302 7.2e-83 PFAM
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
transmembrane domain 819 838 N/A INTRINSIC
low complexity region 854 866 N/A INTRINSIC
low complexity region 871 884 N/A INTRINSIC
transmembrane domain 902 921 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Pgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Pgap1 APN 1 54492021 splice site probably benign
IGL01111:Pgap1 APN 1 54530943 missense probably benign 0.17
IGL01406:Pgap1 APN 1 54533414 splice site probably null
IGL01592:Pgap1 APN 1 54521311 missense probably damaging 1.00
IGL02005:Pgap1 APN 1 54551055 missense probably damaging 0.99
IGL02026:Pgap1 APN 1 54494819 missense probably benign 0.05
IGL02086:Pgap1 APN 1 54547988 missense probably damaging 1.00
IGL02354:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02361:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02995:Pgap1 APN 1 54493350 missense probably benign 0.19
IGL03012:Pgap1 APN 1 54533413 splice site probably benign
R0044:Pgap1 UTSW 1 54493368 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0352:Pgap1 UTSW 1 54486458 splice site probably benign
R1297:Pgap1 UTSW 1 54528523 missense possibly damaging 0.94
R1429:Pgap1 UTSW 1 54494861 missense probably benign 0.01
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1542:Pgap1 UTSW 1 54492090 missense probably benign 0.16
R1816:Pgap1 UTSW 1 54492057 missense probably damaging 0.99
R1817:Pgap1 UTSW 1 54535969 missense probably benign 0.15
R1905:Pgap1 UTSW 1 54511961 missense probably benign 0.26
R2006:Pgap1 UTSW 1 54551061 missense possibly damaging 0.76
R3551:Pgap1 UTSW 1 54530143 missense possibly damaging 0.89
R3833:Pgap1 UTSW 1 54557465 missense probably damaging 0.99
R3901:Pgap1 UTSW 1 54493348 missense probably benign
R4487:Pgap1 UTSW 1 54528592 missense probably benign 0.26
R4874:Pgap1 UTSW 1 54530137 missense probably damaging 0.96
R5184:Pgap1 UTSW 1 54481856 missense probably damaging 1.00
R6181:Pgap1 UTSW 1 54512777 missense probably benign 0.05
R6212:Pgap1 UTSW 1 54514893 missense probably damaging 0.99
R6269:Pgap1 UTSW 1 54548008 nonsense probably null
R6525:Pgap1 UTSW 1 54481889 missense probably benign 0.00
R6944:Pgap1 UTSW 1 54530161 missense probably damaging 1.00
R7214:Pgap1 UTSW 1 54543061 missense possibly damaging 0.47
R7256:Pgap1 UTSW 1 54493207 critical splice donor site probably null
R7290:Pgap1 UTSW 1 54548066 missense possibly damaging 0.45
R7356:Pgap1 UTSW 1 54530134 missense probably benign 0.10
R7525:Pgap1 UTSW 1 54530922 missense probably benign 0.26
R7602:Pgap1 UTSW 1 54543186 missense probably damaging 1.00
R7897:Pgap1 UTSW 1 54551008 missense probably damaging 1.00
X0025:Pgap1 UTSW 1 54481870 missense probably benign 0.26
X0060:Pgap1 UTSW 1 54536034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATCTGAGGTTCAATGCA -3'
(R):5'- CACATGGTGGCTCACAACCA -3'

Sequencing Primer
(F):5'- TAATGTCTTCCAGGAGCCTACGAAG -3'
(R):5'- GGCTCACAACCATTTATATTGTGACC -3'
Posted On2020-07-28