Incidental Mutation 'R8278:Slc26a9'
ID638049
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131761776 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 487 (A487D)
Ref Sequence ENSEMBL: ENSMUSP00000036916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000186122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049027
AA Change: A487D

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: A487D

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186122
AA Change: S436R
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268
AA Change: S436R

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0588:Slc26a9 UTSW 1 131754011 splice site probably benign
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R0926:Slc26a9 UTSW 1 131753216 missense probably benign 0.40
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4064:Slc26a9 UTSW 1 131763187 missense probably benign 0.01
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6255:Slc26a9 UTSW 1 131763909 missense probably benign 0.00
R6418:Slc26a9 UTSW 1 131758490 missense probably benign 0.06
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
R7202:Slc26a9 UTSW 1 131762788 missense possibly damaging 0.77
R7214:Slc26a9 UTSW 1 131759473 missense probably damaging 0.99
R7238:Slc26a9 UTSW 1 131758818 nonsense probably null
R7389:Slc26a9 UTSW 1 131769248 makesense probably null
R7439:Slc26a9 UTSW 1 131762818 missense probably damaging 1.00
R7441:Slc26a9 UTSW 1 131762818 missense probably damaging 1.00
R7470:Slc26a9 UTSW 1 131764043 missense probably benign 0.33
R7515:Slc26a9 UTSW 1 131753973 missense probably damaging 0.99
R7652:Slc26a9 UTSW 1 131763896 missense probably benign 0.06
R7655:Slc26a9 UTSW 1 131763244 missense possibly damaging 0.88
R7656:Slc26a9 UTSW 1 131763244 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAAGCGCCAGTACGTGACTC -3'
(R):5'- TGAGGTCTGGTAGCATGTCC -3'

Sequencing Primer
(F):5'- GTACGTGACTCACTGCAAAAATG -3'
(R):5'- CTGGTAGCATGTCCCTGTGC -3'
Posted On2020-07-28