Mutagenetix > Incidental Mutation

Incidental Mutation 'R0724:Pdia3'

63805

Institutional Source

Beutler Lab

Gene Symbol

Pdia3

Ensembl Gene

ENSMUSG00000027248

Gene Name

protein disulfide isomerase associated 3

Synonyms

ERp61, Plca, PDI, Grp58, Erp, PDI-Q2, ERp57, ERp60

MMRRC Submission

038906-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0724 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

121413775-121438687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121432377 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 275 (G275S)

Ref Sequence

ENSEMBL: ENSMUSP00000028683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028683] [ENSMUST00000135079]

AlphaFold

P27773

Predicted Effect

probably damaging
Transcript: ENSMUST00000028683
AA Change: G275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028683
Gene: ENSMUSG00000027248
AA Change: G275S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Thioredoxin	26	131	5.2e-36	PFAM
Pfam:Thioredoxin_6	160	355	2e-29	PFAM
Pfam:Thioredoxin	377	483	9.5e-33	PFAM
low complexity region	487	503	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130450

Predicted Effect

probably benign
Transcript: ENSMUST00000135079

SMART Domains

Protein: ENSMUSP00000119337
Gene: ENSMUSG00000027248

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	3	105	5.1e-35	PFAM

Meta Mutation Damage Score

0.4603

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die by E13.5 with minor changes in ER calcium capacity and unfolded protein response in mouse embryonic fibroblasts. Mice homozygous for a gene trap allele die prior to birth while heterozygous mice exhibit abnormalbone volume bone morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,763	E136G	probably benign	Het
Adgre4	T	A	17: 55,852,281	S655R	probably benign	Het
Ak7	T	A	12: 105,710,254	V71E	probably benign	Het
Ank2	C	T	3: 126,962,337	R1077H	probably damaging	Het
Anxa3	A	G	5: 96,828,748	T198A	possibly damaging	Het
Atp1a1	A	T	3: 101,592,439	I109N	possibly damaging	Het
Camta1	A	G	4: 151,077,892	I119T	probably damaging	Het
Carm1	A	G	9: 21,587,374	Y504C	probably damaging	Het
Casp1	C	T	9: 5,303,077	P177L	probably benign	Het
Ccdc122	C	A	14: 77,092,077		probably benign	Het
Ces1a	A	G	8: 93,039,513	S158P	probably damaging	Het
Ces3a	T	A	8: 105,050,195	D103E	possibly damaging	Het
Clstn1	A	C	4: 149,643,624	D583A	possibly damaging	Het
Corin	A	G	5: 72,332,795		probably benign	Het
Cryba1	T	C	11: 77,719,457	D144G	probably damaging	Het
Cwf19l2	G	T	9: 3,421,377		probably null	Het
Dis3l	T	C	9: 64,307,126	T1027A	possibly damaging	Het
Dopey2	A	G	16: 93,762,325	E653G	probably benign	Het
Dst	A	G	1: 34,188,677	I1459V	probably benign	Het
Dyrk3	T	C	1: 131,130,140	T64A	probably benign	Het
Emp2	C	T	16: 10,284,615	C111Y	probably benign	Het
Enam	A	G	5: 88,501,994	Y454C	probably damaging	Het
Fbn1	A	T	2: 125,352,064	C1328S	probably benign	Het
Gata3	T	C	2: 9,874,575	T197A	probably benign	Het
Gm1043	A	G	5: 37,187,229	T212A	probably damaging	Het
Gm15448	T	C	7: 3,816,872	N564S	possibly damaging	Het
H2-Eb1	T	C	17: 34,315,032		probably benign	Het
Hand1	T	C	11: 57,831,680	H36R	probably damaging	Het
Hmgcs2	C	A	3: 98,297,001	Y239*	probably null	Het
Hoxc12	A	G	15: 102,937,055	Y68C	probably damaging	Het
Inpp5a	A	G	7: 139,516,663	I143V	probably benign	Het
Klhdc2	C	A	12: 69,297,048	F18L	probably benign	Het
Kpnb1	T	C	11: 97,178,304	Y251C	probably damaging	Het
Lrch4	A	T	5: 137,637,308	N315I	probably damaging	Het
Map3k10	A	C	7: 27,668,355	V286G	probably damaging	Het
Myo7b	G	A	18: 32,005,549		probably benign	Het
Nlrp2	G	T	7: 5,319,222	L809I	probably damaging	Het
Oacyl	T	C	18: 65,737,825		probably benign	Het
Olfr735	A	G	14: 50,345,917	V175A	possibly damaging	Het
Paxbp1	T	A	16: 91,036,536	D270V	probably damaging	Het
Plcb3	G	A	19: 6,963,392	R359C	probably damaging	Het
Plcxd3	G	A	15: 4,516,868	S118N	probably damaging	Het
Ptpn14	T	C	1: 189,850,947	S664P	possibly damaging	Het
Sirt1	T	C	10: 63,323,973	I443V	possibly damaging	Het
Slc7a8	G	A	14: 54,735,186		probably benign	Het
Smim14	A	G	5: 65,453,339		probably benign	Het
Sost	C	T	11: 101,966,918	C19Y	probably benign	Het
Tcaf1	G	T	6: 42,675,367	A727E	probably damaging	Het
Thoc1	T	C	18: 9,963,829	L144P	probably damaging	Het
Tmem132b	A	T	5: 125,783,421	T577S	possibly damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tshr	T	C	12: 91,538,286	F666S	probably damaging	Het
Wdr1	A	G	5: 38,540,862	V192A	possibly damaging	Het
Zfp697	T	C	3: 98,428,166	W416R	probably damaging	Het

Other mutations in Pdia3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Pdia3	APN	2	121414178	missense	probably damaging	1.00
IGL00777:Pdia3	APN	2	121429556	missense	probably damaging	1.00
IGL02020:Pdia3	APN	2	121436419	splice site	probably null
IGL02437:Pdia3	APN	2	121433648	missense	probably damaging	1.00
IGL02988:Pdia3	UTSW	2	121429556	missense	probably damaging	1.00
PIT4812001:Pdia3	UTSW	2	121433530	missense	probably damaging	1.00
R0242:Pdia3	UTSW	2	121414111	missense	probably damaging	1.00
R0242:Pdia3	UTSW	2	121414111	missense	probably damaging	1.00
R0606:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R0612:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R0658:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R0730:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R0880:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R0882:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R1157:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R1160:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R1238:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R1619:Pdia3	UTSW	2	121432377	missense	probably damaging	1.00
R1853:Pdia3	UTSW	2	121431663	missense	probably benign	0.20
R1854:Pdia3	UTSW	2	121431663	missense	probably benign	0.20
R2014:Pdia3	UTSW	2	121434820	missense	probably damaging	1.00
R2103:Pdia3	UTSW	2	121433993	missense	probably damaging	1.00
R4160:Pdia3	UTSW	2	121414115	missense	probably damaging	1.00
R4628:Pdia3	UTSW	2	121414139	missense	possibly damaging	0.91
R5032:Pdia3	UTSW	2	121414139	missense	probably benign	0.28
R5279:Pdia3	UTSW	2	121414003	unclassified	probably benign
R5598:Pdia3	UTSW	2	121414130	missense	possibly damaging	0.53
R5815:Pdia3	UTSW	2	121436411	nonsense	probably null
R7162:Pdia3	UTSW	2	121429521	missense	probably benign	0.00
R7729:Pdia3	UTSW	2	121432357	missense	possibly damaging	0.77
X0012:Pdia3	UTSW	2	121435945	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TGTGTGGACCCATTACCTCTTACAGTG -3'
(R):5'- GCAGTTTCTGGAGCTATGTGTTCCC -3'

Sequencing Primer
(F):5'- GCATTGTGTTGATAATGACTTCCTC -3'
(R):5'- gtccagattagccacaaattcag -3'

Posted On

2013-07-30