Incidental Mutation 'R8278:Chit1'
ID638050
Institutional Source Beutler Lab
Gene Symbol Chit1
Ensembl Gene ENSMUSG00000026450
Gene Namechitinase 1 (chitotriosidase)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134111242-134151540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134150594 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 380 (R380Q)
Ref Sequence ENSEMBL: ENSMUSP00000083666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086475] [ENSMUST00000159963] [ENSMUST00000160060]
Predicted Effect probably benign
Transcript: ENSMUST00000086475
AA Change: R380Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000083666
Gene: ENSMUSG00000026450
AA Change: R380Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159963
AA Change: R380Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123979
Gene: ENSMUSG00000026450
AA Change: R380Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160060
SMART Domains Protein: ENSMUSP00000124331
Gene: ENSMUSG00000026450

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 354 2.47e-131 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced pulmonary fibrosis induced by bleomycin or IL13 expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Smad9 A T 3: 54,789,266 T251S probably benign Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Chit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Chit1 APN 1 134145254 missense probably damaging 1.00
IGL01344:Chit1 APN 1 134151314 missense probably damaging 1.00
IGL01352:Chit1 APN 1 134148490 missense probably damaging 1.00
IGL01620:Chit1 APN 1 134150519 missense probably damaging 1.00
IGL01795:Chit1 APN 1 134148429 missense probably damaging 1.00
IGL01924:Chit1 APN 1 134149410 missense probably benign 0.05
IGL02000:Chit1 APN 1 134146675 missense probably benign 0.01
IGL02891:Chit1 APN 1 134145310 missense probably benign 0.38
Debt UTSW 1 134149425 missense probably null 1.00
R0790:Chit1 UTSW 1 134138752 missense probably benign 0.00
R0838:Chit1 UTSW 1 134143337 nonsense probably null
R1783:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1783:Chit1 UTSW 1 134149395 missense probably benign 0.03
R1784:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1863:Chit1 UTSW 1 134151250 missense probably damaging 0.96
R1940:Chit1 UTSW 1 134145418 critical splice donor site probably null
R1950:Chit1 UTSW 1 134151230 missense probably damaging 1.00
R2045:Chit1 UTSW 1 134151144 missense probably benign 0.05
R2260:Chit1 UTSW 1 134151127 missense probably benign
R4552:Chit1 UTSW 1 134144051 missense probably benign 0.17
R5386:Chit1 UTSW 1 134149454 missense probably damaging 1.00
R5975:Chit1 UTSW 1 134146626 missense probably damaging 1.00
R6134:Chit1 UTSW 1 134144060 missense possibly damaging 0.94
R6196:Chit1 UTSW 1 134146643 nonsense probably null
R6482:Chit1 UTSW 1 134143242 missense probably damaging 0.98
R6923:Chit1 UTSW 1 134149425 missense probably null 1.00
R6952:Chit1 UTSW 1 134143284 missense probably damaging 1.00
R7022:Chit1 UTSW 1 134151292 missense probably benign 0.44
R7198:Chit1 UTSW 1 134150491 missense possibly damaging 0.87
R8079:Chit1 UTSW 1 134144027 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCTGTGGTAACTGAGCCTGTAG -3'
(R):5'- GAGGGAATCCATTACTACGCC -3'

Sequencing Primer
(F):5'- TGGTAACTGAGCCTGTAGCAACC -3'
(R):5'- CCGTCAGGTATTGTCAGCAG -3'
Posted On2020-07-28