Incidental Mutation 'R8278:Smad9'
ID638053
Institutional Source Beutler Lab
Gene Symbol Smad9
Ensembl Gene ENSMUSG00000027796
Gene NameSMAD family member 9
SynonymsSMAD8A, MADH6, SMAD8B, Madh9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8278 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location54755582-54801257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54789266 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 251 (T251S)
Ref Sequence ENSEMBL: ENSMUSP00000029371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029371]
Predicted Effect probably benign
Transcript: ENSMUST00000029371
AA Change: T251S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029371
Gene: ENSMUSG00000027796
AA Change: T251S

DomainStartEndE-ValueType
DWA 29 138 3.47e-68 SMART
DWB 234 406 1.02e-106 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that act as downstream effectors of the bone morphogenetic protein (BMP) signaling pathway. The encoded protein is phosphorylated by BMP receptors, which stimulates its binding to SMAD4 and translocation into the nucleus, where it functions as a regulator of transcription. Activity of this protein is important for embryonic development. Mutation of this gene results in defects in pulmonary vasculature. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice in which exon 3 was deleted are viable and fertile. Mutant mice in which a neo cassette is inserted in exon 3 resulting in a hypomorphic allele exhibit reduced midbrain and hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,882,474 probably null Het
4930562C15Rik A T 16: 4,850,176 Q477L probably benign Het
Adcy10 A T 1: 165,503,288 D40V probably damaging Het
Cab39l T C 14: 59,539,113 Y248H probably damaging Het
Casr G T 16: 36,515,649 D99E probably damaging Het
Cdh16 T C 8: 104,618,475 E364G probably benign Het
Cep104 C T 4: 153,983,665 T189I possibly damaging Het
Chd7 T A 4: 8,862,485 probably null Het
Chit1 G A 1: 134,150,594 R380Q probably benign Het
Cpne2 A G 8: 94,554,688 K174R probably damaging Het
Dchs2 T A 3: 83,271,003 I1121N probably damaging Het
Fgf6 A T 6: 127,015,818 Y78F probably damaging Het
H2-T10 A T 17: 36,118,940 N320K probably benign Het
Heatr3 A T 8: 88,156,733 N398I possibly damaging Het
Hrh4 T C 18: 13,007,227 S60P probably damaging Het
Ikbip A G 10: 91,096,328 H278R probably benign Het
Jmy A T 13: 93,464,716 I394N probably damaging Het
Klhl8 T C 5: 103,874,241 E314G probably benign Het
Lhx9 A T 1: 138,838,586 C164S probably damaging Het
Loxl3 G T 6: 83,048,716 G352C probably damaging Het
Lrrk1 A G 7: 66,278,684 F1232S probably benign Het
Mpnd A G 17: 56,012,469 T311A probably benign Het
Mpp7 A T 18: 7,444,025 D132E probably benign Het
Nck2 T C 1: 43,554,580 S316P probably damaging Het
Nckap5 T C 1: 126,027,772 S348G probably damaging Het
Nyap1 C T 5: 137,731,815 R790H probably damaging Het
Olfr1489 C T 19: 13,633,594 T161I possibly damaging Het
Park2 A T 17: 12,050,722 N421Y probably benign Het
Pdcd11 G A 19: 47,106,297 V507I probably damaging Het
Pdzd2 T C 15: 12,375,909 H1380R probably benign Het
Pgap1 C T 1: 54,490,271 V763I probably benign Het
Pnmal2 G T 7: 16,946,338 V416L probably damaging Het
Prpf4 T C 4: 62,415,256 probably null Het
Psmb5 C T 14: 54,617,885 G36D probably benign Het
Ptprq A G 10: 107,686,378 S571P possibly damaging Het
Rap1gap A C 4: 137,717,437 S254R probably damaging Het
Rufy2 A T 10: 63,007,693 D492V probably benign Het
Ryr2 C A 13: 11,595,506 E4145* probably null Het
Sgsm1 A G 5: 113,260,092 F898L probably damaging Het
Slc26a9 C A 1: 131,761,776 A487D possibly damaging Het
Slc6a15 T C 10: 103,394,029 probably null Het
Socs3 A T 11: 117,967,652 C193* probably null Het
Sox6 T A 7: 115,476,964 D813V probably damaging Het
Taf2 A T 15: 55,065,965 L65* probably null Het
Taf6 G A 5: 138,179,835 A468V probably benign Het
Tmem71 T C 15: 66,555,112 D78G probably damaging Het
Tob2 T C 15: 81,851,087 N227S probably benign Het
Trim34a C A 7: 104,249,416 Q180K probably damaging Het
Ugt1a9 T C 1: 88,071,656 L276P possibly damaging Het
Wdr33 G A 18: 31,827,352 R23Q possibly damaging Het
Wnt7b T G 15: 85,543,686 N189H Het
Zfp609 G A 9: 65,697,522 A1308V possibly damaging Het
Other mutations in Smad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Smad9 APN 3 54786172 missense possibly damaging 0.95
IGL02666:Smad9 APN 3 54782467 missense probably damaging 1.00
IGL03346:Smad9 APN 3 54789215 missense probably benign
R1839:Smad9 UTSW 3 54789179 splice site probably benign
R1888:Smad9 UTSW 3 54789179 splice site probably benign
R3622:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3623:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3624:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3708:Smad9 UTSW 3 54786181 missense probably benign
R4469:Smad9 UTSW 3 54782761 missense probably damaging 1.00
R4756:Smad9 UTSW 3 54794453 missense possibly damaging 0.50
R4938:Smad9 UTSW 3 54789230 missense probably benign 0.00
R5139:Smad9 UTSW 3 54797406 missense possibly damaging 0.94
R5783:Smad9 UTSW 3 54794442 missense probably benign 0.15
R6200:Smad9 UTSW 3 54789186 missense probably benign
R6437:Smad9 UTSW 3 54786084 missense probably benign 0.33
R6478:Smad9 UTSW 3 54782443 missense probably damaging 1.00
R6552:Smad9 UTSW 3 54782746 missense probably damaging 1.00
R7058:Smad9 UTSW 3 54786193 missense probably benign 0.01
R7314:Smad9 UTSW 3 54789323 missense probably benign 0.00
R7492:Smad9 UTSW 3 54786326 splice site probably null
R7683:Smad9 UTSW 3 54789264 missense probably damaging 1.00
Z1177:Smad9 UTSW 3 54786222 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTAAAGCGGTCACCTGCGC -3'
(R):5'- CTTATAGCGGGCTTCCTACG -3'

Sequencing Primer
(F):5'- CGCTTCCTGTTGCAATCGTGAG -3'
(R):5'- CAGGCTTCTTGGAGCTCAGAAG -3'
Posted On2020-07-28